ing5a

Ensembl ID:
ENSDARG00000022413
ZFIN ID:
ZDB-GENE-031016-1
Description:
inhibitor of growth protein 5 [Source:RefSeq peptide;Acc:NP_001093519]
Human Orthologue:
ING5
Human Description:
inhibitor of growth family, member 5 [Source:HGNC Symbol;Acc:19421]
Mouse Orthologue:
Ing5
Mouse Description:
inhibitor of growth family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1922816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1695 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040701 Nonsense 204 242 6 8
Genomic Location:
Chromosome 22 (position 2193969)
KASP Assay ID:
554-1641.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAACCTACCTACTGCCTGTGTCACCAAGTGTCATACGGAGAAATGATC[G/T]GATGTGACAACCCAGATGTAAGAGCRCAATCAAATTTTTTCAGAGAGATA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3r820t4h