rrp12

Ensembl ID:
ENSDARG00000022410
ZFIN ID:
ZDB-GENE-050706-182
Description:
RRP12-like protein [Source:RefSeq peptide;Acc:NP_001025447]
Human Orthologue:
RRP12
Human Description:
ribosomal RNA processing 12 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29100]
Mouse Orthologue:
Rrp12
Mouse Description:
ribosomal RNA processing 12 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147437]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42231 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3834 Nonsense Mutation detected in F1 DNA During 2016
sa35526 Nonsense Mutation detected in F1 DNA During 2016
sa8658 Nonsense Available for shipment Available now
sa9602 Nonsense Available for shipment Available now
sa13242 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034829 Essential Splice Site 471 1283 12 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9

The following transcripts of ENSDARG00000022410 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31581543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAAACACGTCATCTGGAAATGGGGCTTGCGTTCTGAAAATGTTTCAG[T/A]AAGCTACCTGTGACCCTATACCCCCCTACCCCACTTCCTCACTTGTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034829 Nonsense 567 1283 15 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9

The following transcripts of ENSDARG00000022410 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31579256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTGTGTGTGGTTGCAGTGATGACCTTGAGTTTCCACGCAGTTGGT[T/A]GATTCCGGTCATTAGAGATCATGTAAAGAACTCTCAGCTGGCTTACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034829 Nonsense 603 1283 16 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9

The following transcripts of ENSDARG00000022410 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31579059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTATATAAACTCTTAATCTTTGGTTTATTTCAGCCGATGAACTGGAG[C/T]AGTCAGGGCAGAAGCTCATGGCAAAGGTTTATCAGACGTTACAGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034829 Nonsense 613 1283 16 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9
ENSDART00000034829 Nonsense 613 1283 16 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9

The following transcripts of ENSDARG00000022410 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31579027)
KASP Assay ID:
2260-6599.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCYGATGAACTGGAGCAGTCAGGGCAGAAGCTCATGGCAAAGGTTTA[T/A]CAGACGTTACAGATGCAGGTATGATGTGTATTTTAAGACTGTAAACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034829 Nonsense 613 1283 16 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9
ENSDART00000034829 Nonsense 613 1283 16 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9

The following transcripts of ENSDARG00000022410 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31579027)
KASP Assay ID:
2260-6599.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCYGATGAACTGGAGCAGTCAGGGCAGAAGCTCATGGCAAAGGTTTA[T/A]CAGACGTTACAGATGCAGGTATGATGTGTATTTTAAGACTGTAAACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034829 Nonsense 735 1283 19 34
ENSDART00000134343   None 100 None 5
ENSDART00000145887   None 276 None 9

The following transcripts of ENSDARG00000022410 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31576142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKGTTTGTTCCTGTTGTTTCAGATGGTGTGCACATTTCTTCAAAAAGCAT[T/A]GGAGAGACTCAATGCWGACAACACTGAGTTTACCAGGTAATACAGCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link