mtmr1b

Ensembl ID:
ENSDARG00000022378
ZFIN ID:
ZDB-GENE-050327-48
Description:
myotubularin related protein 1b [Source:RefSeq peptide;Acc:NP_001014352]
Human Orthologue:
MTMR1
Human Description:
myotubularin related protein 1 [Source:HGNC Symbol;Acc:7449]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12509 Nonsense Available for shipment Available now
sa23988 Nonsense Mutation detected in F1 DNA During 2014
sa16800 Splice Site, Nonsense Available for shipment Available now
sa23989 Nonsense Mutation detected in F1 DNA During 2014
sa13357 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029599 Nonsense 176 649 7 16
ENSDART00000145123 Nonsense 154 179 6 6
ENSDART00000147519 Nonsense 97 263 4 7

The following transcripts of ENSDARG00000022378 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 33065578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACNTTTTTTTTTCTTCCACAGGACTTGAGAACCCCAYGGTTTGCATA[C/A]AAGAAGGAGGGACAAAGCAATTTGGAAATGTTTAAAATATTGTCAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029599 Nonsense 181 649 7 16
ENSDART00000145123 Nonsense 159 179 6 6
ENSDART00000147519 Nonsense 102 263 4 7

The following transcripts of ENSDARG00000022378 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 33065591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCCACAGGACTTGAGAACCCCACGGTTTGCATACAAGAAGGAGGGA[C/T]AAAGCAATTTGGAAATGTTTAAAATATTGTCAAAGTATGCGTTCCCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029599 Splice Site, Nonsense 229 649 8 16
ENSDART00000145123 None None 179 None 6
ENSDART00000147519 Splice Site, Nonsense 150 263 5 7

The following transcripts of ENSDARG00000022378 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 33065828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAGAGGATGGATGGAAAATYTACGACCCAGTTGCTGAGTACAAGAGA[C/T]AGGTAACAACTGTCATGCCCAGTGTTGGGGGTAATGCATTACACGTAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029599 Nonsense 416 649 12 16
ENSDART00000145123 None None 179 None 6
ENSDART00000147519 None None 263 None 7

The following transcripts of ENSDARG00000022378 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 33079711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTTCTTTTTTAGCTCTTGCTAGCTGGTGCTGTTCGGATTGCCGAC[C/T]GAATCGAGTCAGGGAAGACATCAGTGGTGGTCCACTGCAGTGATGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029599 Nonsense 590 649 15 16
ENSDART00000145123 None None 179 None 6
ENSDART00000147519 None None 263 None 7

The following transcripts of ENSDARG00000022378 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 33083019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTATATCCAATTGCCAGTCTTAGACATCTAGAGCTTTGGGTCAGTTA[T/G]TATGTGCGCTGGAACCCTCGCATGAGGCCACAGGTGAGAAGGGATTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bdhjknzu