nek1

Ensembl ID:
ENSDARG00000022350
ZFIN ID:
ZDB-GENE-040730-1
Description:
Novel protein similar to human and mouse NIMA (Never in mitosis gene a)-related kinase 1 (NEK1) [Sou
Human Orthologue:
NEK1
Human Description:
NIMA (never in mitosis gene a)-related kinase 1 [Source:HGNC Symbol;Acc:7744]
Mouse Orthologue:
Nek1
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 1 Gene [Source:MGI Symbol;Acc:MGI:97303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa486 Essential Splice Site Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa486
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035239 Essential Splice Site 1152 1200 26 28
Genomic Location (Zv9):
Chromosome 20 (position 23691527)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23810328
KASP Assay ID:
554-0338.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGCCATGGGCTTTGAGAACTTCATCCAGGCCTACAACAAGATCAAGG[T/A]CTGAATTAAATGTCAAGTCTTACTGTGTGTCTACAGTGGGATTCGGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link