LOC556118

Ensembl ID:
ENSDARG00000022334
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17190 Nonsense Available for shipment Available now
sa24888 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa18652 Nonsense Available for shipment Available now
sa4409 Nonsense Mutation detected in F1 DNA During 2014
sa13306 Nonsense Available for shipment Available now
sa3796 Nonsense Mutation detected in F1 DNA During 2014
sa2612 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 None None 365 None 7
ENSDART00000125446 Nonsense 231 741 1 7
Genomic Location:
Chromosome 11 (position 12281480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCGATACATGTCCCAAGCCCTGTTCCTTTACCTGCCCTGACACCTA[T/A]CTTAAAACTTGCTCTGAGACATGCTCTGAGACCTGTCCCAAGCCCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 Essential Splice Site 48 365 None 7
ENSDART00000125446 Missense 420 741 1 7
Genomic Location:
Chromosome 11 (position 12280915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCGGTGAAAGATTTGGTGCTAGAATCATGGCTGGAGGGTGTTATGGC[A/G]GGGATTATGACTATCACCAGTTGAATGAGAAGGCCACCATGCAAAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 Nonsense 190 365 4 7
ENSDART00000125446 Nonsense 562 741 3 7
Genomic Location:
Chromosome 11 (position 12278987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCCGACCTGGARTTGCAGATCTGCACTTTGGARGAGGAACTTGTGTA[T/A]TTGAGAAAAACTCACCARGAGGTTGGTAGCTGTTTCTCTATAGCAGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 Nonsense 227 365 5 7
ENSDART00000125446 Nonsense 599 741 4 7
Genomic Location:
Chromosome 11 (position 12278786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTRTGTGTTGAAGTGGACGCCGCTCCTCAGCAAGACCTCAAAAAGGTTT[T/A]GGATGACATCCGTTGTTATTATGACACCATCATAGACAAACACTGCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 Nonsense 233 365 5 7
ENSDART00000125446 Nonsense 605 741 4 7
Genomic Location:
Chromosome 11 (position 12278767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCTCCTCAGCAAGACCTCAAAAAGGTTTWGGATGACATCCGWTGTTA[T/G]TATGAMACCATCATAGACAARCACTGCACAGAACAGGAGTGCTGGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 Nonsense 295 365 7 7
ENSDART00000125446 Nonsense 667 741 6 7
Genomic Location:
Chromosome 11 (position 12273350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTAAATTTGTCTCTATTTTCTTTCTAACTCTTTCAACGCCAAAACAG[A/T]AAGGAGCTCTGGAGTGTTCACTGCTGGAAACAGAGGCGCGTTACAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2612
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041914 Nonsense 316 365 7 7
ENSDART00000125446 Nonsense 688 741 6 7
Genomic Location:
Chromosome 11 (position 12273285)
KASP Assay ID:
554-3284.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCACTGCTGGAAACAGAGGCGCGTTACAGCACTATGCTAGCAGGCTA[T/G]CAGAAACACATCAACGCATATGAGGCAGAGCTCKGTCAGGTTCGCGCYGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v25pvt1a