or115-5

Ensembl ID:
ENSDARG00000022319
ZFIN ID:
ZDB-GENE-070806-7
Description:
odorant receptor, family F, subfamily 115, member 5 [Source:RefSeq peptide;Acc:NP_001121877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43711 Nonsense Mutation detected in F1 DNA During 2016
sa15877 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032154 Nonsense 123 313 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39123880)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40263945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATATTTACAACAGCAAGCCACACTGCCCTAGTAACCATGGCCTATGAC[A/T]GACAAGTGGCTATATGCAATCCATTACTGTACACAGCTGTAATGACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032154 Nonsense 239 313 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39124228)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40264293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGCTTGTRTAATCAGTAAAAGCAARGCACTCAACAGCAAAGCCATC[A/T]AAACAKGTAGCAGTCACATAGCTGTATATTTAATAATGTTTGTTTCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link