dspa

Ensembl ID:
ENSDARG00000022309
ZFIN ID:
ZDB-GENE-030131-2743
Description:
Novel protein similar to vertebrate desmoplakin (DSP) [Source:UniProtKB/TrEMBL;Acc:A2AVI3]
Human Orthologue:
DSP
Human Description:
desmoplakin [Source:HGNC Symbol;Acc:3052]
Mouse Orthologue:
Dsp
Mouse Description:
desmoplakin Gene [Source:MGI Symbol;Acc:MGI:109611]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19650 Nonsense Available for shipment Available now
sa30809 Nonsense Mutation detected in F1 DNA During 2017
sa13356 Nonsense Available for shipment Available now
sa302 Nonsense F2 line generated During 2017
sa38306 Nonsense Mutation detected in F1 DNA During 2017
sa19651 Nonsense Available for shipment Available now
sa39744 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 595 2244 13 21
Genomic Location (Zv9):
Chromosome 2 (position 1952320)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1807406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGCCGAGGACATCATTAAAGTCCACGAGGCTCGTCTGACCGAG[A/T]AAGAAACCTCTTCTCTTGACCTGAACGAAGTGGAAAAGTACTGCATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 621 2244 14 21
Genomic Location (Zv9):
Chromosome 2 (position 1954635)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1809721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGAATCTGATGTCTTGTTTTCTGTAGACTATGAAAGCAGAGCTGGAG[C/T]AGAAGAAGGGTGTTTTGAAGGCGATGGAGACGGAGCTGTCTAAAGCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 960 2244 19 21
Genomic Location (Zv9):
Chromosome 2 (position 1960075)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1815161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGCGCAAGAGACAGAAAGAACTGGAGGAGCTCACTTTGTCCAAAAGT[C/T]AATTTGAAAGAGCCATCAAAGASAAAGAGCGRGAGATTGAACGGCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa302
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1197 2244 19 21
Genomic Location (Zv9):
Chromosome 2 (position 1960787)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1815873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCRTTATAAAGAGAGAGTTGGATGTACARAAAAGTGATAAGATGAAGT[T/A]GGAGCAGAATGCCACCAGGTTGCAGAGTCGCATAAATGAACTGCAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1293 2244 19 21
Genomic Location (Zv9):
Chromosome 2 (position 1961074)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1816160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTTCGCAGTGCAAAAGACGAGTTGGAGAGAAGCCTGAAAGAGTAT[A/T]AAATCACAGTAGAGAATCTGACCAAAGTCAATGCAGAACTGAAGGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1882 2244 21 21
Genomic Location (Zv9):
Chromosome 2 (position 1963207)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1818293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTACCATCGAGAGTTAATCGACTATGACACCTTTCTGGAACTTTCCGAA[C/T]AAGAGTGCGAGTGGGAGGAGATCACGATTGAAACATCTGATGGAAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029371 Nonsense 1918 2244 21 21
Genomic Location (Zv9):
Chromosome 2 (position 1963315)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1818401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGTCGATCGCAAAACTGGAATCCAGTATGACATTCAGGAGTCCCTA[C/T]AGAGGGGAATTATCAATAAACAAACTTTGGAAAAGTACCGTGCAGGGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link