hig1

Ensembl ID:
ENSDARG00000022303
ZFIN ID:
ZDB-GENE-030826-15
Description:
HIG1 domain family member 1A [Source:RefSeq peptide;Acc:NP_956394]
Human Orthologue:
HIGD1A
Human Description:
HIG1 hypoxia inducible domain family, member 1A [Source:HGNC Symbol;Acc:29527]
Mouse Orthologue:
Higd1a
Mouse Description:
HIG1 domain family, member 1A Gene [Source:MGI Symbol;Acc:MGI:1930666]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14226 Nonsense Available for shipment Available now
sa32823 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029347 Nonsense 36 99 3 4
Genomic Location (Zv9):
Chromosome 2 (position 1972443)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1827529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYTTTGACTGTCTTTCAAGGGATGGCTGGGTTCTTTGCCATTGTGGCGTA[C/A]AGACTGTTCAAGCTGAAGAGCCGAGGAGACACMAAGATGTCAGTGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029347 Essential Splice Site 71 99 4 4
Genomic Location (Zv9):
Chromosome 2 (position 1974911)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1829997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCATTAAGACCTGTGGTATAATGTGTTGTATGTCTGTTTTTGTGTAC[A/T]GGAGTCATCTATTCGATGTACAACGAGTATATTCTGAAACCCGCCGAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link