hig1

Ensembl ID:
ENSDARG00000022303
ZFIN ID:
ZDB-GENE-030826-15
Description:
HIG1 domain family member 1A [Source:RefSeq peptide;Acc:NP_956394]
Human Orthologue:
HIGD1A
Human Description:
HIG1 hypoxia inducible domain family, member 1A [Source:HGNC Symbol;Acc:29527]
Mouse Orthologue:
Higd1a
Mouse Description:
HIG1 domain family, member 1A Gene [Source:MGI Symbol;Acc:MGI:1930666]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14226 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029347 Nonsense 36 99 3 4
Genomic Location:
Chromosome 2 (position 1972443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYTTTGACTGTCTTTCAAGGGATGGCTGGGTTCTTTGCCATTGTGGCGTA[C/A]AGACTGTTCAAGCTGAAGAGCCGAGGAGACACMAAGATGTCAGTGCACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wscu4sb3