ptpro

Ensembl ID:
ENSDARG00000022297
ZFIN IDs:
ZDB-GENE-070424-54, ZDB-GENE-070424-54, ZDB-GENE-070424-54
Description:
receptor-type tyrosine-protein phosphatase O [Source:RefSeq peptide;Acc:NP_001077283]
Human Orthologue:
PTPRO
Human Description:
protein tyrosine phosphatase, receptor type, O [Source:HGNC Symbol;Acc:9678]
Mouse Orthologue:
Ptpro
Mouse Description:
protein tyrosine phosphatase, receptor type, O Gene [Source:MGI Symbol;Acc:MGI:1097152]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23601 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049850 Nonsense 117 341 2 6
ENSDART00000060242 Nonsense 47 1203 2 30
ENSDART00000110782   None 87 None 4
ENSDART00000122021 Nonsense 55 1229 2 26
Genomic Location (Zv9):
Chromosome 19 (position 46875987)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 66765
KASP Assay ID:
2261-3724.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGACATTGGGCCGGGTGTGTCTGAGTACGCGGTGCGAGTGTCCGGA[G/T]AGCCGCTCACACACACACTGCTGTTCCAGCAAGCGGCCGACGCGCACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cognitive function: Genome-wide study identifies PTPRO and WDR72 and FOXQ1-SUMO1P1 interaction associated with neurocognitive function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link