brd2a

Ensembl ID:
ENSDARG00000022280
ZFIN ID:
ZDB-GENE-990415-248
Description:
bromodomain-containing protein 2 [Source:RefSeq peptide;Acc:NP_571275]
Human Orthologue:
BRD2
Human Description:
bromodomain containing 2 [Source:HGNC Symbol;Acc:1103]
Mouse Orthologue:
Brd2
Mouse Description:
bromodomain containing 2 Gene [Source:MGI Symbol;Acc:MGI:99495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035967 Nonsense 666 836 10 12
ENSDART00000128438 Nonsense 603 773 13 15

The following transcripts of ENSDARG00000022280 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7788741)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7247280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACGTTTTTCCCACCGCCACTGAGCCACAGTGGCCTCACACCTCACTA[C/A]GACTCCGAGGAAGAGGAGGAAACCAGTCCCATGAGCTACGACGAGAAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link