ch1073-352h10.1

Ensembl ID:
ENSDARG00000022271
ZFIN ID:
ZDB-GENE-081030-23
Description:
similar to Tripartite motif-containing protein 35 (Hemopoietic lineage switch protein 5) [Source:Re
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4202 Nonsense Mutation detected in F1 DNA During 2014
sa19305 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036283 Nonsense 166 452 3 6
ENSDART00000036283 Nonsense 166 452 3 6
Genomic Location:
Chromosome 22 (position 39578684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGRAWGCGTCTGAGATGACTGAAGTGAATGTGGTTTGATTTCAGTAT[C/T]AAGCTAGAAGCACAAAGCATCAGATTAAACAGCAGTTTGAGAAGCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036283 Nonsense 166 452 3 6
ENSDART00000036283 Nonsense 166 452 3 6
Genomic Location:
Chromosome 22 (position 39578684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGATGCGTCTGAGATGACTGAAGTGAATGTGGTTTGATTTCAGTAT[C/T]AAGCTAGAAGCACAAAGCATCAGATTAAACAGCAGTTTGAGAAGCTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/12iqyjn2