prkcbb

Ensembl ID:
ENSDARG00000022254
ZFIN ID:
ZDB-GENE-040426-1178
Description:
Protein kinase C beta type [Source:UniProtKB/Swiss-Prot;Acc:Q7SY24]
Human Orthologue:
PRKCB
Human Description:
protein kinase C, beta [Source:HGNC Symbol;Acc:9395]
Mouse Orthologue:
Prkcb
Mouse Description:
protein kinase C, beta Gene [Source:MGI Symbol;Acc:MGI:97596]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20072 Essential Splice Site Available for shipment Available now
sa13860 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029451 Essential Splice Site 273 670 7 17
ENSDART00000131179 Essential Splice Site 206 603 5 15
Genomic Location (Zv9):
Chromosome 3 (position 35221312)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35006508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTCTTTTGGCATTTCAGAGCTTCAGAAGCAAGGAGTGGACGGATGG[T/A]AAGAAAGCCTGCTAACATGTACATTTGCATCAGTGGAAATGAGGAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029451 Nonsense 662 670 17 17
ENSDART00000131179 Nonsense 595 603 15 15
Genomic Location (Zv9):
Chromosome 3 (position 35333609)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35118805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGAACCTCGACCAAGACGAATTCGAGGGCTTTTCCTTCATAAACCCT[G/T]AATTCCCTGCCATGGAAGCCCAGAGTTAAGGGCGACCCCCTAAAACTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link