LOC555750

Ensembl ID:
ENSDARG00000022203
Human Orthologues:
GTF2I, GTF2IRD1, RP11-301J16.2
Human Descriptions:
general transcription factor IIi [Source:HGNC Symbol;Acc:4659]
GTF2I repeat domain containing 1 [Source:HGNC Symbol;Acc:4661]
Novel protein similar to general transcription factor II, i GTF2I [Source:UniProtKB/TrEMBL;Acc:Q5TBT
Mouse Orthologues:
Gtf2i, Gtf2ird1
Mouse Descriptions:
general transcription factor II I Gene [Source:MGI Symbol;Acc:MGI:1202722]
general transcription factor II I repeat domain-containing 1 Gene [Source:MGI Symbol;Acc:MGI:1861942

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10970 Essential Splice Site Available for shipment Available now
sa14023 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074200 Essential Splice Site 311 973 5 26
Genomic Location:
Chromosome 5 (position 61213856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCCCGCCGAGGAAAAAGCCGTTCAGGCCAAGGAATGTGCTGACAATGG[T/C]AAGAGYGTGTAGGTGCTGCACCATACGGATGTTGTCNKTTTTTWAATRTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074200 Essential Splice Site 553 973 13 26
Genomic Location:
Chromosome 5 (position 61228441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGCGAGTGACCCCTGACCTCTGTCGTCCCAAGGAGCCTGTCGCAGG[T/C]AACAWCAAACTAGCTTATATCCGAACRTACKTCCTTATCCATCTTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/26cjb8l8