LOC555750

Ensembl ID:
ENSDARG00000022203
Human Orthologues:
GTF2I, GTF2IRD1, RP11-301J16.2
Human Descriptions:
general transcription factor IIi [Source:HGNC Symbol;Acc:4659]
GTF2I repeat domain containing 1 [Source:HGNC Symbol;Acc:4661]
Novel protein similar to general transcription factor II, i GTF2I [Source:UniProtKB/TrEMBL;Acc:Q5TBT
Mouse Orthologues:
Gtf2i, Gtf2ird1
Mouse Descriptions:
general transcription factor II I Gene [Source:MGI Symbol;Acc:MGI:1202722]
general transcription factor II I repeat domain-containing 1 Gene [Source:MGI Symbol;Acc:MGI:1861942

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10970 Essential Splice Site Available for shipment Available now
sa38515 Nonsense Mutation detected in F1 DNA During 2016
sa14023 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074200 Essential Splice Site 311 973 5 26
Genomic Location (Zv9):
Chromosome 5 (position 61213856)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58845983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCCCGCCGAGGAAAAAGCCGTTCAGGCCAAGGAATGTGCTGACAATGG[T/C]AAGAGYGTGTAGGTGCTGCACCATACGGATGTTGTCNKTTTTTWAATRTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074200 Nonsense 539 973 13 26
Genomic Location (Zv9):
Chromosome 5 (position 61228397)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58860524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGAATCCAGTGCTTCAACAGAGGAATCCAGTGAGCCTCAGGCTGAG[C/T]GAGTGACCCCTGACCTCTGTCGTCCCAAGGAGCCTGTCGCAGGTAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074200 Essential Splice Site 553 973 13 26
Genomic Location (Zv9):
Chromosome 5 (position 61228441)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58860568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGCGAGTGACCCCTGACCTCTGTCGTCCCAAGGAGCCTGTCGCAGG[T/C]AACAWCAAACTAGCTTATATCCGAACRTACKTCCTTATCCATCTTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link