si:ch211-198d18.2

Ensembl ID:
ENSDARG00000022187
ZFIN ID:
ZDB-GENE-041210-192
Description:
hypothetical protein LOC561983 [Source:RefSeq peptide;Acc:NP_001124071]
Human Orthologue:
USP6NL
Human Description:
USP6 N-terminal like [Source:HGNC Symbol;Acc:16858]
Mouse Orthologue:
Usp6nl
Mouse Description:
USP6 N-terminal like Gene [Source:MGI Symbol;Acc:MGI:2138893]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16612 Essential Splice Site Available for shipment Available now
sa33468 Nonsense Mutation detected in F1 DNA During 2017
sa20282 Nonsense Available for shipment Available now
sa40300 Nonsense Mutation detected in F1 DNA During 2017
sa38440 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Essential Splice Site 25 405 None 13
ENSDART00000100391   None 747 None 14
ENSDART00000123199 Essential Splice Site 26 827 None 14
ENSDART00000143571 Essential Splice Site 43 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22750244)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24093579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGAAGTTGGAACAGGAGCGAGCTGAGATACTCGYMAAATATGATAAGG[T/G]GAGAGAAGACAGCTKATRTTCATTTATGAGCWAACACCCYTCCAAAACWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Nonsense 249 405 9 13
ENSDART00000100391 Nonsense 172 747 10 14
ENSDART00000123199 Nonsense 252 827 10 14
ENSDART00000143571 Nonsense 267 423 10 14
Genomic Location (Zv9):
Chromosome 4 (position 22720062)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24063397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAGCATCATGATCGTATTCTGCAGAAGATGATGCCTAAACTTAAA[C/T]AACATCTAGTAAGACGCATTAACATCTCCAGAACATCACATCACACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627 Nonsense 286 405 11 13
ENSDART00000100391 Nonsense 209 747 12 14
ENSDART00000123199 Nonsense 289 827 12 14
ENSDART00000143571 Nonsense 304 423 12 14
Genomic Location (Zv9):
Chromosome 4 (position 22716736)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24060071
KASP Assay ID:
2259-4954.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGAATAGACTCCATTCACGCTGACACTGAGAATATGGGACATTTA[T/A]ATTCTGGAAGGAGAGCGAGTCCTGACTGCAATGTCTTACACCATCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627   None 405 13 13
ENSDART00000100391 Nonsense 336 747 14 14
ENSDART00000123199 Nonsense 416 827 14 14
ENSDART00000143571   None 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22711625)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24054960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGGTCTCCCCCCTCGTGGTCCAAGCCCTGCCGTAAGTGTCAATAAA[C/T]GAGTAGACTCTGGTCCCGTCACCGATGGCACACCCGAGAGGTACCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038627   None 405 13 13
ENSDART00000100391 Nonsense 545 747 14 14
ENSDART00000123199 Nonsense 625 827 14 14
ENSDART00000143571   None 423 None 14
Genomic Location (Zv9):
Chromosome 4 (position 22710997)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24054332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCCCAAGCAGAGCATGATGCAGTCCAAACCAGAACCCCGTGCCCCTT[T/A]GCACTACCCACCTGGCATGACGCCTGTCTACACTCCCTACATTTCAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link