RGL3 (2 of 3)

Ensembl ID:
ENSDARG00000022185
Description:
ral guanine nucleotide dissociation stimulator-like 3 [Source:HGNC Symbol;Acc:30282]
Human Orthologue:
RGL3
Human Description:
ral guanine nucleotide dissociation stimulator-like 3 [Source:HGNC Symbol;Acc:30282]
Mouse Orthologue:
Rgl3
Mouse Description:
ral guanine nucleotide dissociation stimulator-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918996]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16278 Essential Splice Site Available for shipment Available now
sa13355 Nonsense Available for shipment Available now
sa6028 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19960 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001755 Essential Splice Site 184 717 7 22
Genomic Location:
Chromosome 3 (position 13793450)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGCTCGCTAAACAATATGAAGCGCTCCTTAAGAGATTCCAGACTGAAG[G/A]TYATTACAGGATTGATAYATTAYGAATTATTGCWTTTGTGTTTGATATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001755 Nonsense 225 717 8 22
Genomic Location:
Chromosome 3 (position 13794695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGASGATTTCCTGGATTTTTCCATCATGGGTGTTGCTGAACAGCTCACA[C/T]GAATAGATGCTGTGAGCGCTCKTTTTATTGCTYGCTTYTGATTGGCTCTK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001755 Essential Splice Site 335 717 11 22
Genomic Location:
Chromosome 3 (position 13798875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAACAAAAATCATAATAAAATATAGCTTTAAAAGTAGCCAAGAACAGG[G/C]TAAATTGAAATAAACTCAGCTAAAACTGGAACTTTCTGTAATTTTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001755 Essential Splice Site 417 717 14 22
Genomic Location:
Chromosome 3 (position 13799813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCAATTTATGCTAAGCTAAGCTAAAAGTGCTCCCACCAGACATGAAG[A/G]TCAAAGCACATTGAATGCTTTCTTCTTTCCACAAATTTTAAACAACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001755 Nonsense 605 717 20 22
Genomic Location:
Chromosome 3 (position 13803785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGTCTCATAAAYGCTCGTTCTCCATGACCACCCTGCCTTTCTACAAC[C/T]GACAGGTGGACGACTCCTGCATCATCAGGGTCAGCGTGGAGTTCTGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/01gidyl3