ddx59

Ensembl ID:
ENSDARG00000022177
ZFIN ID:
ZDB-GENE-050208-665
Description:
probable ATP-dependent RNA helicase DDX59 [Source:RefSeq peptide;Acc:NP_001038443]
Human Orthologue:
DDX59
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 [Source:HGNC Symbol;Acc:25360]
Mouse Orthologue:
Ddx59
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI Symbol;Acc:MGI:1915247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10545 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105600 Nonsense 363 584 5 8
ENSDART00000123083 Nonsense 369 584 5 9
ENSDART00000128290 Nonsense 284 505 4 7
Genomic Location (Zv9):
Chromosome 22 (position 22787517)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22399153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAWGACCATCAGACTCTGCTGACRTCAGCCACTATTCCCACYGGCACA[C/T]AGCAGCTGGCAGAGCGTCTCACCCATGACCCAGTGACCATCACCATCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link