prdm10

Ensembl ID:
ENSDARG00000022161
Human Orthologue:
PRDM10
Human Description:
PR domain containing 10 [Source:HGNC Symbol;Acc:13995]
Mouse Orthologue:
Prdm10
Mouse Description:
PR domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2682952]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36721 Nonsense Mutation detected in F1 DNA During 2017
sa25073 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa32216 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059046 Nonsense 182 1188 7 33
ENSDART00000142018   None 732 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42767900)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44357791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCACCCTGACGGAGGCCTCGTCAAGTCCCCTCGGGGCCACAGATT[C/A]AACTGTAGACTCTGAGGACGAGGAAGAAGACAATGATAGCGAGGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059046 Splice Site None 1188 None 33
ENSDART00000142018 Nonsense 611 732 10 12
Genomic Location (Zv9):
Chromosome 18 (position 42726709)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44332081
KASP Assay ID:
554-7372.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAGCACAGCCCAGTTGACACCGGTAACCCTGGCTCAACAGACTCTA[C/T]AGACATCATCCAATCAGACGCAAGGAGCCACACAACATGCCTACCTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059046 Essential Splice Site 1119 1188 31 33
ENSDART00000142018 Essential Splice Site 669 732 11 12
Genomic Location (Zv9):
Chromosome 18 (position 42726449)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44331821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAGCACTCCCGTCACAGCAGCTGTTAACAGCAGTCAGGTCAAAACGG[T/G]GAGTCTGATTAAATGTCTGGGCTCTATATGTAGGACAAATTCTGGGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link