drp2

Ensembl ID:
ENSDARG00000022132
ZFIN ID:
ZDB-GENE-070228-4
Description:
dystrophin related protein 2 [Source:RefSeq peptide;Acc:NP_001074036]
Human Orthologue:
DRP2
Human Description:
dystrophin related protein 2 [Source:HGNC Symbol;Acc:3032]
Mouse Orthologue:
Drp2
Mouse Description:
dystrophin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:107432]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28352 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105543 Essential Splice Site 797 866 20 22
ENSDART00000122310   None 866 None 22
Genomic Location (Zv9):
Chromosome 14 (position 42245764)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40557089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCAACTGGAGTCCCAGCTCCGCAGACTCCGAGAACTACTGCTGCAGG[T/C]GTGTTCAACAGATGCCCGTATATCTTCAAAATGAGAAGCGGGCCCTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link