rbm4.3

Ensembl ID:
ENSDARG00000022129
ZFIN ID:
ZDB-GENE-040426-1938
Description:
hypothetical protein LOC406277 [Source:RefSeq peptide;Acc:NP_998482]
Human Orthologues:
RBM4, RBM4B, RP11-658F2.1
Human Descriptions:
RNA binding motif protein 4 [Source:HGNC Symbol;Acc:9901]
RNA binding motif protein 4B [Source:HGNC Symbol;Acc:28842]
RNA-binding protein 4 isoform 1 [Source:RefSeq peptide;Acc:NP_002887]
Mouse Orthologue:
Rbm4b
Mouse Description:
RNA binding motif protein 4B Gene [Source:MGI Symbol;Acc:MGI:1913954]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12670 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037817 Nonsense 280 341 2 3
ENSDART00000135207 Nonsense 280 341 3 4
ENSDART00000146801   None 7 None 2
Genomic Location (Zv9):
Chromosome 7 (position 23960931)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22522683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCCCCTAWGAGCGACGCCCCCTCCCACCCCCGCCAGCTTCAYTCTATGCA[C/T]GAGACCGCAGTCCCATCAGAYGCGCTCCTCCTGCCCCTCCGGCACCCGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link