cdkal1

Ensembl ID:
ENSDARG00000022122
ZFIN ID:
ZDB-GENE-040426-1443
Description:
CDK5 regulatory subunit-associated protein 1-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PG34]
Human Orthologue:
CDKAL1
Human Description:
CDK5 regulatory subunit associated protein 1-like 1 [Source:HGNC Symbol;Acc:21050]
Mouse Orthologue:
Cdkal1
Mouse Description:
CDK5 regulatory subunit associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1921765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42636 Nonsense Mutation detected in F1 DNA During 2017
sa36008 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029313 Nonsense 345 407 17 18
Genomic Location (Zv9):
Chromosome 16 (position 89571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTCCAGGTGGAGGTGTACGAGTGCGGGAAACACTACATGAAGGGC[C/T]GACCACTGGAGGAGGCGCCACTGCGCACCGCATACACCACTGCACCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029313 Nonsense 378 407 18 18
Genomic Location (Zv9):
Chromosome 16 (position 90220)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTGTTCCTCATCTTGATCTTGTGTTCAGGCCGGTGTGTGTGAGCCG[C/T]AGTGCTGGATGCCGGACGGGATGAGGATTCTGGCTGTGGTTCTGCTTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Birth weight: New loci associated with birth weight identify genetic links between intrauterine growth and adult height and metabolism. (View Study)
  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
  • Body mass index: Meta-analysis identifies common variants associated with body mass index in east Asians. (View Study)
  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Diabetes (gestational): A genome-wide association study of gestational diabetes mellitus in Korean women. (View Study)
  • Glycated hemoglobin levels: Association of glycosylated hemoglobin with the gene encoding CDKAL1 in the Korean Association Resource (KARE) study. (View Study)
  • Ileal carcinoids: A pilot genome-wide association study shows genomic variants enriched in the non-tumor cells of patients with well-differentiated neuroendocrine tumors of the ileum. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Type 2 diabetes: A genome-wide association study identifies GRK5 and RASGRP1 as type 2 diabetes loci in Chinese Hans. (View Study)
  • Type 2 diabetes: A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. (View Study)
  • Type 2 diabetes: A variant in CDKAL1 influences insulin response and risk of type 2 diabetes. (View Study)
  • Type 2 diabetes: Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: SNPs in KCNQ1 are associated with susceptibility to type 2 diabetes in East Asian and European populations. (View Study)
  • Type 2 diabetes: Stratifying type 2 diabetes cases by BMI identifies genetic risk variants in LAMA1 and enrichment for risk variants in lean compared to obese cases. (View Study)
  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)
  • Type 2 diabetes and other traits: Genetic variant near IRS1 is associated with type 2 diabetes, insulin resistance and hyperinsulinemia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link