opn4a

Ensembl ID:
ENSDARG00000022098
ZFIN ID:
ZDB-GENE-070111-2
Description:
Melanopsin-A [Source:UniProtKB/Swiss-Prot;Acc:Q2KNE5]
Human Orthologue:
OPN4
Human Description:
opsin 4 [Source:HGNC Symbol;Acc:14449]
Mouse Orthologue:
Opn4
Mouse Description:
opsin 4 (melanopsin) Gene [Source:MGI Symbol;Acc:MGI:1353425]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12424 Nonsense Available for shipment Available now
sa22280 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037102 Nonsense 18 593 1 11
ENSDART00000122687 Nonsense 19 594 1 11
ENSDART00000128233 Nonsense 18 594 1 12
Genomic Location:
Chromosome 13 (position 22561481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGAGCGGAGCCGCGCACTCTGTGAGGAAGGGCATCTCGTGCCCGACA[C/T]AGGACCCGAACTGCACGCGCATCGTGGAAAGCCTGTCCGCGTGGWACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037102 Nonsense 112 593 3 11
ENSDART00000122687 Nonsense 113 594 3 11
ENSDART00000128233 Nonsense 112 594 3 12
Genomic Location:
Chromosome 13 (position 22581155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGATTGGTTTGTGTGCAGGAGCCGGACCCTGAGGACCCCCGCCAACT[T/A]GTTTATAATAAACCTGGCCATCACAGATTTCCTCATGTGTGCCACGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d4ypnant