tlr4bb

Ensembl ID:
ENSDARG00000022048
ZFIN ID:
ZDB-GENE-040219-9
Description:
toll-like receptor 4b, duplicate b [Source:RefSeq peptide;Acc:NP_997978]
Human Orthologue:
TLR4
Human Description:
toll-like receptor 4 [Source:HGNC Symbol;Acc:11850]
Mouse Orthologue:
Tlr4
Mouse Description:
toll-like receptor 4 Gene [Source:MGI Symbol;Acc:MGI:96824]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9527 Nonsense Available for shipment Available now
sa12965 Nonsense Available for shipment Available now
sa15774 Nonsense Available for shipment Available now
sa4498 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 518 819 3 3
Genomic Location:
Chromosome 13 (position 18576840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCATTGMGAAAGTCTCMATGAGATCTTTTACTGGCAYGCAGAAACTA[C/T]GACATTTATATTTMAGTCGAAACAAATTGATGGTTTTRRACTTTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 562 819 3 3
Genomic Location:
Chromosome 13 (position 18576973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGATAAAAACAGTATAACCACCATCCCACTTGATGTTCTACAAAAGY[T/A]GCCCATGAAYCTTTCTGAGTTTGATTTGTCCTCTAACTCCATCGATTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 688 819 3 3
Genomic Location:
Chromosome 13 (position 18577351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGTTCTTATGACGCATTTGTGATTTTCTCCAGCTATGATGAAGCTT[G/A]GGTCRTGAATGAACTTATGGAGAATCTGGAGAACGGTGTGCCACCTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 811 819 3 3
Genomic Location:
Chromosome 13 (position 18577719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACCTGAAGTGGAGCAGAGACCCTTTGAGCAACATGAGATTCTGGATA[C/T]GACTCAGGAAAGCAATTTTACAGAAATAATCAATGCACTAAACATGTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/truyfu9m