tlr4bb

Ensembl ID:
ENSDARG00000022048
ZFIN ID:
ZDB-GENE-040219-9
Description:
toll-like receptor 4b, duplicate b [Source:RefSeq peptide;Acc:NP_997978]
Human Orthologue:
TLR4
Human Description:
toll-like receptor 4 [Source:HGNC Symbol;Acc:11850]
Mouse Orthologue:
Tlr4
Mouse Description:
toll-like receptor 4 Gene [Source:MGI Symbol;Acc:MGI:96824]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35456 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35457 Nonsense Mutation detected in F1 DNA During 2016
sa9527 Nonsense Available for shipment Available now
sa12965 Nonsense Available for shipment Available now
sa31917 Nonsense Mutation detected in F1 DNA During 2016
sa31918 Nonsense Mutation detected in F1 DNA During 2016
sa15774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Essential Splice Site 30 819 2 3
Genomic Location (Zv9):
Chromosome 13 (position 18575292)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18395327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTATATGCAAATATAAAATATGTAAAACATGTCTTGGTCCTTTAATA[G/A]CTGATAAAGAATAAGGAATATTCATGTTCTGGAAGGAATCTGACTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 488 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18576750)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18396785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAATGGCAGGAAACAGTTTTAGTGGAGATAAATTGAGTTACTTCTTA[C/T]AAAACCTAACAAGCTTGGAGGTTCTTGACATTTCACAGTGTGGCATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 518 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18576840)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18396875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCATTGMGAAAGTCTCMATGAGATCTTTTACTGGCAYGCAGAAACTA[C/T]GACATTTATATTTMAGTCGAAACAAATTGATGGTTTTRRACTTTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 562 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18576973)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGATAAAAACAGTATAACCACCATCCCACTTGATGTTCTACAAAAGY[T/A]GCCCATGAAYCTTTCTGAGTTTGATTTGTCCTCTAACTCCATCGATTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 588 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577052)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTAACTCCATCGATTGCTCCTGCTCTCAGACTGATTTTATTTTGTG[G/A]ATTATTCAAAAACAAAACATTTTAAAACAACTGGAAAACATTCGGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 614 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACTGGAAAACATTCGGTGTAAAACTTTTTCTGCAAATACAGATTTC[A/T]AAGCAATAGACTTTGACATTGACTACTGTGTGCACAAGAAAAGACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034852 Nonsense 688 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 18577351)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18397386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGTTCTTATGACGCATTTGTGATTTTCTCCAGCTATGATGAAGCTT[G/A]GGTCRTGAATGAACTTATGGAGAATCTGGAGAACGGTGTGCCACCTATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link