MAP1A (1 of 2)

Ensembl ID:
ENSDARG00000022045
Description:
microtubule-associated protein 1A [Source:HGNC Symbol;Acc:6835]
Human Orthologue:
MAP1A
Human Description:
microtubule-associated protein 1A [Source:HGNC Symbol;Acc:6835]
Mouse Orthologue:
Mtap1a
Mouse Description:
microtubule-associated protein 1 A Gene [Source:MGI Symbol;Acc:MGI:1306776]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24659 Nonsense Mutation detected in F1 DNA During 2014
sa10906 Nonsense Available for shipment Available now
sa19362 Nonsense Mutation detected in F1 DNA During 2014
sa4308 Nonsense Mutation detected in F1 DNA During 2014
sa1846 Nonsense Available for shipment Available now
sa6130 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067321 Nonsense 475 2253 3 22
Genomic Location:
Chromosome 25 (position 19863104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGCCTTCTAAGAAAGAAACAGACGAGCATGAGGATGTATCTGTAGTC[G/T]AAACAAAGAGTGACTCTGTCAAAGAGAACAAGGTTGAGAAAAAAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067321 Nonsense 774 2253 5 22
ENSDART00000067321 Nonsense 774 2253 5 22
Genomic Location:
Chromosome 25 (position 19862063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTTTGAAGAAGAGGACGTGATTGAAAAAGCTGAGCTGGAGGAGGCT[G/T]AAGATTTAGATGCCATTGCAGATGAAGAAATTAAAGAGCTCTCTCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067321 Nonsense 774 2253 5 22
ENSDART00000067321 Nonsense 774 2253 5 22
Genomic Location:
Chromosome 25 (position 19862063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTTTGAAGAAGAGGACGTGATTGAAAAAGCTGAGCTGGAGGAGGCT[G/T]AAGATTTAGATGCCATTGCAGATGAAGAAATTAAAGAGCTCTCTCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067321 Nonsense 1245 2253 7 22
Genomic Location:
Chromosome 25 (position 19860365)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGTTACAGATAAAGGTGCTGGGAAATCAGAASTGGAGAAAGCTACA[C/T]AGCCCTCTAAAGAGGATTTTGATAAGAAAAACGCAAATGAAGAATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067321 Nonsense 1780 2253 15 22
Genomic Location:
Chromosome 25 (position 19855936)
KASP Assay ID:
554-1837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCAAGATCAAATATCTTCGGCAGAGGAAAAATCWGAGGAAGATATGT[C/A]AAGCATTAAATCTGACAAAGATCATGTCTCTGATCCTAAGCATGTAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067321 Essential Splice Site 1817 2253 16 22
Genomic Location:
Chromosome 25 (position 19855152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGCAAAGAAAARGACAAAGAGAGTAAAAAACAAACTGAAGAAATTAT[T/A]ATGGAAAAATATAGCAAAAAYGTACCYGAGTCTAGCCAGCATACTGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ds9yl6lo