KIAA1797

Ensembl ID:
ENSDARG00000022020
Description:
KIAA1797 [Source:HGNC Symbol;Acc:23377]
Human Orthologue:
KIAA1797
Human Description:
KIAA1797 [Source:HGNC Symbol;Acc:23377]
Mouse Orthologue:
BC057079
Mouse Description:
cDNA sequence BC057079 Gene [Source:MGI Symbol;Acc:MGI:2676921]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20893 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10081 Essential Splice Site Available for shipment Available now
sa18867 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 518 1797 15 49
Genomic Location:
Chromosome 7 (position 20150230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAG[G/A]TAAAGCCATTACGATGCACAACATGAACCATTAATCTCATAAGAGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 518 1797 15 49
Genomic Location:
Chromosome 7 (position 20150231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAGG[T/C]AAAGCCATTACGATGCACARCAYGAACCATTWATCTCATAAGWGAATACW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 675 1797 19 49
Genomic Location:
Chromosome 7 (position 20156781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGGTCCTGAAGGCCACAGCTGAACTTCTGGCATTAGTACCAGATT[T/A]AAATGTCAAAACAGAGGAATATGAGGCACGAGACCATCACCGTACTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x3wvyzud