KIAA1797

Ensembl ID:
ENSDARG00000022020
Description:
KIAA1797 [Source:HGNC Symbol;Acc:23377]
Human Orthologue:
KIAA1797
Human Description:
KIAA1797 [Source:HGNC Symbol;Acc:23377]
Mouse Orthologue:
BC057079
Mouse Description:
cDNA sequence BC057079 Gene [Source:MGI Symbol;Acc:MGI:2676921]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26920 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40858 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20893 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10081 Essential Splice Site Available for shipment Available now
sa18867 Nonsense Mutation detected in F1 DNA During 2016
sa40859 Nonsense Mutation detected in F1 DNA During 2016
sa34032 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34033 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa26920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 299 1797 10 49
Genomic Location:
Chromosome 7 (position 20128283)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTCTCTGCTTCACACACTCCACCACATTATACCTGCACATGCAGAG[G/A]TGAATGCACACACACTGCAATAACAATGCTTTTCTTACTTCGATTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 328 1797 11 49
Genomic Location:
Chromosome 7 (position 20130266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCTGCTGAATGCCTCTGTCTCTCAGCAAACGGCGCTCCTAGATCTTG[G/A]TAAAACCCCTCTTGCTCTCTGAAGCCTTCATATTGACACGCCACGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 518 1797 15 49
Genomic Location:
Chromosome 7 (position 20150230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAG[G/A]TAAAGCCATTACGATGCACAACATGAACCATTAATCTCATAAGAGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 518 1797 15 49
Genomic Location:
Chromosome 7 (position 20150231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCTCTCTCTGTTCTCTATACTCTGCCCAAACTGGGAACTCATAAGG[T/C]AAAGCCATTACGATGCACARCAYGAACCATTWATCTCATAAGWGAATACW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 675 1797 19 49
Genomic Location:
Chromosome 7 (position 20156781)
KASP Assay ID:
2259-8622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGGTCCTGAAGGCCACAGCTGAACTTCTGGCATTAGTACCAGATT[T/A]AAATGTCAAAACAGAGGAATATGAGGCACGAGACCATCACCGTACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 739 1797 22 49
Genomic Location:
Chromosome 7 (position 20159911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGGGATCTTGCTTTCAGGCTAGGCCCATACCCAAGCAACCTGAAGTC[G/T]AGGATGAAGTGAAGCAAAATGAGGAGGAGAATGAGGAGGAGGAAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Essential Splice Site 1229 1797 33 49
Genomic Location:
Chromosome 7 (position 20175534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAAGCATGAACACTCTTCGCGCCCTGACCGAGGAAAGTCAACAGG[T/C]GAGAGAGACCTCGAACTGACTGTTTCACAACCAGTATCATACGCTAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037846 Nonsense 1658 1797 46 49
Genomic Location:
Chromosome 7 (position 20191285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAATGGAGTGGCTGCTGGAGTTAATGGGCCACATCAGAAATGTGGCATA[T/A]GGATCTCCCTCTGTTAAATGTGTGGATGTTCTACAGGTATTTGCATTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link