PPP2R2A (2 of 2)

Ensembl ID:
ENSDARG00000021996
Description:
protein phosphatase 2, regulatory subunit B, alpha [Source:HGNC Symbol;Acc:9304]
Human Orthologue:
PPP2R2A
Human Description:
protein phosphatase 2, regulatory subunit B, alpha [Source:HGNC Symbol;Acc:9304]
Mouse Orthologue:
Ppp2r2a
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform Gene [Source:MGI Sy

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15515 Nonsense Available for shipment Available now
sa34290 Nonsense Mutation detected in F1 DNA During 2017
sa21187 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028983 Nonsense 94 455 3 9
Genomic Location (Zv9):
Chromosome 8 (position 5472027)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5187431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACAAYGTCTACAGCACTTTCCAGAGTCACGAGCCGGAGTTCGACTA[T/A]CTGAAGAGTCTGGAAATCGAGGAAAAGAKCAATAAGATCCGCTGGCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028983 Nonsense 370 455 9 9
Genomic Location (Zv9):
Chromosome 8 (position 5450929)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5208529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTCATTATTTCACATCTCTCTCCAGCGAGGTCATGACTGGCTCCTA[C/A]AACAACTTCTTCCGGATGTTTGAGCGTGAGGGCCAGCGAGACGTGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028983 Nonsense 410 455 9 9
Genomic Location (Zv9):
Chromosome 8 (position 5450811)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5208647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCTCCCCCGGCTGCCCGCTGAAGAGCTGGCGCGTGTCCACCGGCAGC[C/T]GACGCAAGAGGAACGAGATCGGCGTCGACTGTCTGGACTTCAGCCGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link