si:ch211-24c14.1

Ensembl ID:
ENSDARG00000021987
ZFIN ID:
ZDB-GENE-100917-2
Human Orthologues:
EPPK1, PLEC
Human Descriptions:
epiplakin 1 [Source:HGNC Symbol;Acc:15577]
plectin [Source:HGNC Symbol;Acc:9069]
Mouse Orthologue:
Plec
Mouse Description:
plectin Gene [Source:MGI Symbol;Acc:MGI:1277961]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42650 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12243 Essential Splice Site Available for shipment Available now
sa14343 Nonsense Available for shipment Available now
sa14270 Nonsense Available for shipment Available now
sa42651 Nonsense Mutation detected in F1 DNA During 2017
sa36029 Nonsense Mutation detected in F1 DNA During 2017
sa16747 Nonsense Available for shipment Available now
sa28576 Nonsense Mutation detected in F1 DNA During 2017
sa36030 Nonsense Mutation detected in F1 DNA During 2017
sa15190 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Essential Splice Site 41 4506 None 32
ENSDART00000144558   None 4530 None 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6664713)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5509244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACTTTTACTATCAGGGAATGCTCAAAGCCTTGGAGGGCAGGAAAGG[T/C]ACTTAGGAAACTTGGAGAAGTATTAGTTTTTATTTGTCATGTCCGCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Essential Splice Site 699 4506 17 32
ENSDART00000144558 Essential Splice Site 723 4530 19 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6719094)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5563625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGACAGACTCATTAAAGACGGACATCCAGGCAAGAAGACTGTGGAG[G/A]TAAGCAGATTTTAAATGAAAGGTCTTCTACTCAAGAAGYTGCATTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 802 4506 20 32
ENSDART00000144558 Nonsense 826 4530 22 36
ENSDART00000014024 Nonsense 802 4506 20 32
ENSDART00000144558 Nonsense 826 4530 22 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6720084)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5564615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCGCCAACCTGAACAAGAGAGCCAAATCTGTGATCCAGCTGAAGCCA[C/T]GRGACCCCACCTGCCCCTTCAGAGGAAAAYTGCCCATCCAGGCYGTGTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 802 4506 20 32
ENSDART00000144558 Nonsense 826 4530 22 36
ENSDART00000014024 Nonsense 802 4506 20 32
ENSDART00000144558 Nonsense 826 4530 22 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6720084)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5564615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCGCCAACCTGAACAAGAGAGCCAAATCTGTGATCCAGCTGAAGCCA[C/T]GRGACCCCACCTGCCCCTTCAGAGGAAAAYTGCCCATCCAGGCYGTGTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 2217 4506 31 32
ENSDART00000144558 Nonsense 2241 4530 33 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6741453)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5585984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATGAAGAGCTTCATCGACTGAAGGATGAGGTCGGTGACGCTGTTAAA[C/T]AGAAAGCCCAGGTAGAGGAGGAACTATTCAAAGTCAGGATTCAAATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 2503 4506 32 32
ENSDART00000144558 Nonsense 2527 4530 34 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6742544)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5587075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCAGACATTTATGTCGGAAAAAGAGATGCTGTTGAAGAAGGAAAAA[C/T]AAATAGAAGATGAAAAGAAGAGGTTAGAGAGTCAATTTGAAGAGGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 2578 4506 32 32
ENSDART00000144558 Nonsense 2602 4530 34 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6742769)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5587300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCAACAAACAAAAGGAGATGCARRAGCTTGAAAGGAAAAAGCTTGAA[C/T]AAGAAAGGATGCTTGCTGAGGAAAACCAACAACTGCGTGAGAAACTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 3022 4506 32 32
ENSDART00000144558 Nonsense 3046 4530 34 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6744101)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5588632
KASP Assay ID:
2260-9153.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGAAAGGCACTAACTGCATTGCAGGAGTAATTGTTGACTCAACCAAA[C/T]AAACAATGTCATTTTATGATGCCATGAAAGGCGACACGATGAGACCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 3303 4506 32 32
ENSDART00000144558 Nonsense 3327 4530 34 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6744945)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5589476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAGGGCTGCTTTAAGGGACTTAGAGCTCCTGTTCCAGCCAAGTCAT[T/A]GTTTGACTCCAAAATCATTGACAAGCCAACCTATGATTTGCTAGAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014024 Nonsense 3833 4506 32 32
ENSDART00000144558 Nonsense 3857 4530 34 36

The following transcripts of ENSDARG00000021987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 6746536)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5591067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGTTCAAGGATATGTRGATCCATTAACTRATGAAAAGWTGTCATA[C/A]GCTCAGCTTCTGAAAAGATGCAAAGTTGACAAAGATGGGCTGCATCTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link