ercc2

Ensembl ID:
ENSDARG00000021985
ZFIN ID:
ZDB-GENE-040426-997
Description:
TFIIH basal transcription factor complex helicase subunit [Source:RefSeq peptide;Acc:NP_957220]
Human Orthologue:
ERCC2
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 2 [Source:HGNC S
Mouse Orthologue:
Ercc2
Mouse Description:
excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene [Source:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22641 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007925 Nonsense 143 645 6 24
ENSDART00000100683 Nonsense 143 643 6 23
ENSDART00000141618 Nonsense 143 760 6 23
Genomic Location:
Chromosome 15 (position 23043134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAAAAGAAGTAGATGGAAAATGTCACAGTCTGACAGCATCGTATATT[C/T]GAGCGCAGCATCAGAGTAACCCAAATCAGCCTGTCTGCCAGTTTTATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ltadulj5