mical3

Ensembl ID:
ENSDARG00000021979
ZFIN ID:
ZDB-GENE-050126-2
Description:
Novel protein similar to vertebrate flavoprotein oxidoreductase MICAL3 (MICAL3) [Source:UniProtKB/Tr
Human Orthologues:
MICAL3, MICAL3
Human Descriptions:
microtubule associated monoxygenase, calponin and LIM domain containing 3 [Source:HGNC Symbol;Acc:24
microtubule associated monoxygenase, calponin and LIM domain containing 3 [Source:HGNC Symbol;Acc:24
Mouse Orthologues:
Mical3, Mical3
Mouse Descriptions:
microtubule associated monoxygenase, calponin and LIM domain containing 3 Gene [Source:MGI Symbol;Ac
microtubule associated monoxygenase, calponin and LIM domain containing 3 Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36582 Nonsense Mutation detected in F1 DNA During 2016
sa36583 Nonsense Mutation detected in F1 DNA During 2016
sa16748 Nonsense Available for shipment Available now
sa36584 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496   None 196 None 5
ENSDART00000028938 Nonsense 691 1011 15 21
ENSDART00000101026 Nonsense 691 2269 14 40
ENSDART00000101035   None 255 None 15
Genomic Location (Zv9):
Chromosome 18 (position 10295622)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10878868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAAAAGAAAAGGAGCTGGATGGACTAGGGAAAAGACGAAAGACGAGC[C/T]AGGCTGGACAATCGGAGGACGTAAGGCCATATCATGCTGGATCACTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496   None 196 None 5
ENSDART00000028938 Nonsense 909 1011 20 21
ENSDART00000101026 Nonsense 1184 2269 27 40
ENSDART00000101035   None 255 None 15
Genomic Location (Zv9):
Chromosome 18 (position 10325511)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10908757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCAAACGTCTGAAAGGGACTCCGGAAAGGATCGAGCTGGAGAACTA[T/A]CGTTTGTCAATGATGAGGGAGGAGGAGCTGGAGGAGGTGCCGGAGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496   None 196 None 5
ENSDART00000028938   None 1011 None 21
ENSDART00000101026 Nonsense 1563 2269 32 40
ENSDART00000101035   None 255 None 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10337209)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10920455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAAGAGTGCAGAGATTAGAAAAAGTTTAGGGCTYACTCCCCTGGAA[C/T]GAAGCAAAACTGYGGTGGAGAAGAGCATTGTGAAAACKCCAACACCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496   None 196 None 5
ENSDART00000028938   None 1011 None 21
ENSDART00000101026 Essential Splice Site 2018 2269 None 40
ENSDART00000101035   None 255 None 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10338576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10921822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGACTCGGGGAAGAAGAAAGATTCACCCCTGGACAGGTCCTCAGG[T/C]CAGCTGGAAGTTTTTCATTTGAATGGCTCATCTTTTTTTCTAGCAGTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link