mical3

Ensembl ID:
ENSDARG00000021979
ZFIN ID:
ZDB-GENE-050126-2
Description:
Novel protein similar to vertebrate flavoprotein oxidoreductase MICAL3 (MICAL3) [Source:UniProtKB/Tr
Human Orthologues:
MICAL3, MICAL3
Human Descriptions:
microtubule associated monoxygenase, calponin and LIM domain containing 3 [Source:HGNC Symbol;Acc:24
microtubule associated monoxygenase, calponin and LIM domain containing 3 [Source:HGNC Symbol;Acc:24
Mouse Orthologues:
Mical3, Mical3
Mouse Descriptions:
microtubule associated monoxygenase, calponin and LIM domain containing 3 Gene [Source:MGI Symbol;Ac
microtubule associated monoxygenase, calponin and LIM domain containing 3 Gene [Source:MGI Symbol;Ac

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4034 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7850 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16748 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496 None None 196 None 5
ENSDART00000028938 Essential Splice Site None 1011 None 21
ENSDART00000101026 None None 2269 None 40
ENSDART00000101035 Essential Splice Site None 255 None 15
Genomic Location:
Chromosome 18 (position 10268362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTGTTATAATGCCAAAAATGACTAATCATTTCTCTTGTTCTTCATTC[A/C]GGGTGAAAATGTCCTAYGGAGGAAGTTGAATCTCAANNNNACAGACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496 Essential Splice Site 157 196 4 5
ENSDART00000028938 Essential Splice Site 634 1011 13 21
ENSDART00000101026 Essential Splice Site 634 2269 12 40
ENSDART00000101035 Essential Splice Site 216 255 14 15
Genomic Location:
Chromosome 18 (position 10294706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTCAGTCAGTTCTACGAGATGTTCAAGGACACGGTGCCACCTGGTGG[T/C]GAGTTGCAGCTCTACAATMGCTAGAAAACTGGGTTTTAGAGKGTTGGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014496 None None 196 None 5
ENSDART00000028938 None None 1011 None 21
ENSDART00000101026 Nonsense 1563 2269 32 40
ENSDART00000101035 None None 255 None 15

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 18 (position 10337209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAAGAGTGCAGAGATTAGAAAAAGTTTAGGGCTYACTCCCCTGGAA[C/T]GAAGCAAAACTGYGGTGGAGAAGAGCATTGTGAAAACKCCAACACCCGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cff4p3d6