tnc

Ensembl ID:
ENSDARG00000021948
ZFIN ID:
ZDB-GENE-980526-104
Description:
tenascin C [Source:RefSeq peptide;Acc:NP_570982]
Human Orthologue:
TNC
Human Description:
tenascin C [Source:HGNC Symbol;Acc:5318]
Mouse Orthologue:
Tnc
Mouse Description:
tenascin C Gene [Source:MGI Symbol;Acc:MGI:101922]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8813 Nonsense Mutation detected in F1 DNA During 2016
sa40443 Nonsense Mutation detected in F1 DNA During 2016
hu3513 Nonsense Confirmed mutation in F2 line Unknown
hu3583 Nonsense Confirmed mutation in F2 line Unknown
hu3580 Nonsense Confirmed mutation in F2 line Unknown
sa33618 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20438 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1576 Nonsense Available for shipment Available now
sa33617 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20437 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Nonsense 513 1811 2 22
ENSDART00000078607 Nonsense 513 1506 2 22
ENSDART00000131729 Nonsense 513 1811 3 23
ENSDART00000137717 Nonsense 513 1720 2 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30241630)
KASP Assay ID:
2259-5902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGACTGCAGTATCAAAACCTGCCCTAATCACTGCCATGGACAGGGA[C/T]AGTKTATAGATGGTAAATGCRTTTGTCATGACGGCTTTGCTGGAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Nonsense 549 1811 2 22
ENSDART00000078607   None 1506 None 22
ENSDART00000131729 Nonsense 549 1811 3 23
ENSDART00000137717 Nonsense 549 1720 2 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30241522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACCTGCCCTAATCACTGCCATGGACGTGGACGTTGCGTTGATGGC[A/T]AATGCATTTGCCATGATGGTTTTGCTGGAGAAGACTGCAACATCAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3513
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Nonsense 721 1811 3 22
ENSDART00000078607 Nonsense 684 1506 4 22
ENSDART00000131729 Nonsense 721 1811 4 23
ENSDART00000137717 Nonsense 721 1720 3 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30239776)
KASP Assay ID:
554-0397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTCGCCTGGGTTAATGAGATGCTTGTGACAGAGTATCTTATCACCTA[T/A]GTACCTACGGCTCCTGGAGGTTTGGAGATGGAAATGAGAGTATCTGGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu3583
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Nonsense 721 1811 3 22
ENSDART00000078607 Nonsense 684 1506 4 22
ENSDART00000131729 Nonsense 721 1811 4 23
ENSDART00000137717 Nonsense 721 1720 3 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30239776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTCGCCTGGGTTAATGAGATGCTTGTGACAGAGTATCTTATCACCTA[T/A]GTACCTACGGCTCCTGGAGGTTTGGAGATGGAAATGAGAGTATCTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3580
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Nonsense 800 1811 4 22
ENSDART00000078607 Nonsense 763 1506 5 22
ENSDART00000131729 Nonsense 800 1811 5 23
ENSDART00000137717 Nonsense 800 1720 4 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30239461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATTCAAATCCGTGAAAGAGACTTCAGTGGAGGTTGAGTGGGACCCCT[T/A]GAACATCCCGTTTGATGGCTGGAATCTGATCTTCAGAAACACAGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Essential Splice Site 866 1811 5 22
ENSDART00000078607 Essential Splice Site 829 1506 6 22
ENSDART00000131729 Essential Splice Site 866 1811 6 23
ENSDART00000137717 Essential Splice Site 866 1720 5 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30238601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGAACAACACCCGTGGACCCCCAGCCAGCAAGAACGTTGTCACAAG[T/A]AAGCAGCTGCCGACTGTAACTAAACTAGTCTGCTGTTTTTCAGAAACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Essential Splice Site 955 1811 6 22
ENSDART00000078607 Essential Splice Site 918 1506 7 22
ENSDART00000131729 Essential Splice Site 955 1811 7 23
ENSDART00000137717 Essential Splice Site 955 1720 6 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30233510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCCGGGGAGAGATGAGCAGCTTCCCCATCTATGAGACCTTCACAACAG[G/T]TATGAACACTTTTTAAGAACTAGAAATGCTTCCAGGTCATCCAAAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Nonsense 990 1811 7 22
ENSDART00000078607 Nonsense 953 1506 8 22
ENSDART00000131729 Nonsense 990 1811 8 23
ENSDART00000137717 Nonsense 990 1720 7 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30230495)
KASP Assay ID:
554-1519.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTCTGGAGTGGAGAAACAGCAGAGCCAACGTCCTCAATTACCGTGTC[A/T]AATACGGCCCACTTTCTGGAGGGGAGCATGGAGAGCTGGTCTTCCCCAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Essential Splice Site 1360 1811 13 22
ENSDART00000078607 Essential Splice Site 1232 1506 13 22
ENSDART00000131729 Essential Splice Site 1360 1811 14 23
ENSDART00000137717 Essential Splice Site 1269 1720 12 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30210879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGTTAAGCGACGAGTAGCTGATTGCAGGTCTCTGTCTCCCCCTGCA[G/T]GCAGTCCTCTGACACTGAGAGTGGATGGAGGAGAGTCTCAAGCCATGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026107 Essential Splice Site 1635 1811 None 22
ENSDART00000078607 Essential Splice Site None 1506 None 22
ENSDART00000131729 Essential Splice Site 1635 1811 None 23
ENSDART00000137717 Essential Splice Site 1544 1720 None 21

The following transcripts of ENSDARG00000021948 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30203144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTCTTCTATCAATAAAATAAAAAGTCAATACTATATCGTTGTACCTC[A/G]GGTGTTTGTGAGGCGGCAGAGTGGCAAAGTGGAGTTTTTCAGAAACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link