si:ch211-199m3.4

Ensembl ID:
ENSDARG00000021913
ZFIN ID:
ZDB-GENE-041014-334
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RH81]
Mouse Orthologue:
AC122332.1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43482 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038535 Essential Splice Site 275 1402 6 25
ENSDART00000135845   None 538 None 10
Genomic Location (Zv9):
Chromosome 20 (position 33742821)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33815334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGTTCTGATAAGTCTGATGATGAAGGCAAAACTCCAAGCAAGAATG[G/A]TTTGCAGTTTTATCATCAATTATAGCTTTATGCTTTACTTGAGCATCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link