rela

Ensembl ID:
ENSDARG00000021907
ZFIN ID:
ZDB-GENE-040825-4
Description:
V-rel reticuloendotheliosis viral oncogene homolog A [Source:UniProtKB/TrEMBL;Acc:B3DHW2]
Human Orthologue:
RELA
Human Description:
v-rel reticuloendotheliosis viral oncogene homolog A (avian) [Source:HGNC Symbol;Acc:9955]
Mouse Orthologue:
Rela
Mouse Description:
v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene [Source:MGI Symbol;Acc:MGI:103290]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33990 Nonsense Mutation detected in F1 DNA During 2017
sa20841 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126388 Nonsense 99 588 4 13
Genomic Location (Zv9):
Chromosome 7 (position 697363)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 648083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCACACCCACACGAGCTGGTGGGAAAAGACTGTAAACATGGCTACTA[T/A]GAGGCAGATCTGCAGGAGCGCAGGATACACAGGTGTGTGTGGGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126388 Essential Splice Site 292 588 8 13
Genomic Location (Zv9):
Chromosome 7 (position 701457)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 644207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCGAGGTCAGCGAGCCCATGGACTTCCAGTACCTGCCCTCAGACCCGG[G/A]TGAGCTTTATTACAGTGTTGCCATTACATACTGCATTAATACCTAGTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link