b4galt7

Ensembl ID:
ENSDARG00000021899
ZFIN ID:
ZDB-GENE-040727-3
Description:
beta-1,4-galactosyltransferase 7 [Source:RefSeq peptide;Acc:NP_001003417]
Human Orthologue:
B4GALT7
Human Description:
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) [Source:HGNC
Mouse Orthologue:
B4galt7
Mouse Description:
xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) Gene [Source:M

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39001 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22486 Essential Splice Site Available for shipment Available now
sa35695 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037999 Essential Splice Site 203 317 3 6
Genomic Location (Zv9):
Chromosome 14 (position 27394538)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26087335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTATGTTGGAGGAATCCTGCTGCTCACTAAGAAACATTATCTGGCGG[T/C]AAGAAACCCAAAGTCTTTGGAACATTCTGGGATTTTCCGAATTTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037999 Essential Splice Site 231 317 4 6
Genomic Location (Zv9):
Chromosome 14 (position 27394370)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26087167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAGATGACGAGTTTTTCAGGAGACTGAAAGCAGCTAATCTTGAGG[T/G]ACATGATATAATCTAATCTAATCTAATATAATATAATATAATATAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037999 Nonsense 274 317 6 6
Genomic Location (Zv9):
Chromosome 14 (position 27391305)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26084102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCAGCTTCTGTCTGCTTTTGGCAGGAGCAGTTTAAGGTGGACCCT[G/T]AGGGTGGCCTGAGTAACCTTCGCTACAAGGTGGAGTCCAGAAAAGAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link