asap3

Ensembl ID:
ENSDARG00000021896
ZFIN ID:
ZDB-GENE-050913-39
Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 [Source:RefSeq peptide;Acc:NP_001035081]
Human Orthologue:
ASAP3
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:14987]
Mouse Orthologue:
Asap3
Mouse Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2684986]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23092 Nonsense Mutation detected in F1 DNA During 2014
sa25041 Nonsense Mutation detected in F1 DNA During 2014
sa10680 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036622 Nonsense 55 184 4 8
ENSDART00000130080 Nonsense 189 991 6 26

The following transcripts of ENSDARG00000021896 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 27050035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGATCCGATTGGACATGACAGACACAGCGGAGGACATGGAAAGAGAA[C/T]GAAGGAACTTCCAGCTGCAGATGTGTGAGGTATTTGGAGGCACTCGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036622 None None 184 None 8
ENSDART00000130080 Nonsense 472 991 15 26

The following transcripts of ENSDARG00000021896 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 27040052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTATCGAGTGTTCAGGAATCCATCGTGAGCTCGGAGTACATCAGTCA[C/T]GAATTCAGTCTTTAACTCTCGATGTGCTGAGCACCTCTGAGCTTCTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036622 None None 184 None 8
ENSDART00000130080 Essential Splice Site 488 991 16 26

The following transcripts of ENSDARG00000021896 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 27039638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNTGAATGAAGTGTACAGATGTRTTCATTAGATATGTTTTGATTCACA[G/A]TTGGCAGTGAGCATTGGAAATGCCAGGTTTAATGACATCATGGAGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qimbwtta