disc1

Ensembl ID:
ENSDARG00000021895
ZFIN IDs:
ZDB-GENE-090122-1, ZDB-GENE-090122-1
Description:
disrupted in schizophrenia 1 [Source:RefSeq peptide;Acc:NP_001135735]
Human Orthologue:
DISC1
Human Description:
disrupted in schizophrenia 1 [Source:HGNC Symbol;Acc:2888]
Mouse Orthologues:
AC168060.2, Disc1
Mouse Descriptions:
disrupted in schizophrenia 1 Gene [Source:MGI Symbol;Acc:MGI:2447658]
Disrupted in schizophrenia 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q811T9]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17522 Essential Splice Site Available for shipment Available now
sa30671 Nonsense Mutation detected in F1 DNA During 2017
sa42305 Nonsense Mutation detected in F1 DNA During 2017
sa8625 Nonsense Mutation detected in F1 DNA During 2017
sa294 Nonsense Confirmed mutation in F2 line During 2017
sa42304 Nonsense Mutation detected in F1 DNA During 2017
sa7379 Missense, Splice Site Mutation detected in F1 DNA During 2017
sa35594 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Essential Splice Site 32 994 1 15
ENSDART00000121745 Essential Splice Site 32 994 1 15
Genomic Location (Zv9):
Chromosome 13 (position 50122988)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48854026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAAACTGACAYAGACTCTCCATGTCACCGGTGTGCTGTRAGGACAGG[T/A]AAGACAAAACTGCGATTATTGTTCATATGTACAACGAAATAGYGTGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 230 994 2 15
ENSDART00000121745 Nonsense 230 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103532)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAATCACTTAAGC[C/T]AATCGGAAACCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 250 994 2 15
ENSDART00000121745 Nonsense 250 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103472)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAGTGTTCCAATCAACCAATCAGAAACCAGCAGTGCCCCAAAAAGC[C/T]AATCAAACTCAGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 310 994 2 15
ENSDART00000121745 Nonsense 310 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50103291)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48834329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCCAGTGAGCCAATCAAATKCAGACTTTTTAAATCCTCCATCTGCTT[T/A]AATGAATCACTTGAACCAATCAGAAACTGTGCTTATTCCAATGAACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa294
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 437 994 2 15
ENSDART00000121745 Nonsense 437 994 2 15
Genomic Location (Zv9):
Chromosome 13 (position 50102911)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48833949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATACAAAAGAAAACATCCAGGATTCGGATTCTGGCTCTCTGGACGCT[G/T]AAATCACGTCTTCACACTCCATTGACTCTTCAGACTCGACTTCGTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 774 994 9 15
ENSDART00000121745 Nonsense 774 994 9 15
Genomic Location (Zv9):
Chromosome 13 (position 50080543)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48811581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACCTGAGCCGCATGAAGGAGAAACACAAGCACATCAAGCTGGAGCTG[C/T]AGAACGGAGAAGCTCAGTATGGTGAGAAACACTCAACATTCACACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Splice Site None 994 None 15
ENSDART00000121745 Missense 937 994 14 15
Genomic Location (Zv9):
Chromosome 13 (position 50035691)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48766729
KASP Assay ID:
554-4369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGAGTAGATGATGTTGTGATCAGATTTTCTTTAACTGAAAGCCACT[C/T]TCTCTGGAGAGGGAGGTCCWGGAGCTGAAGTCTGCTCTTCAGGCGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030939 Nonsense 976 994 15 15
ENSDART00000121745 Nonsense 976 994 15 15
Genomic Location (Zv9):
Chromosome 13 (position 50035573)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48766611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGAGGATGAAGAAGACGAAGAGAAATACTGTGATGTAGAAGAAGAA[C/T]AGGTTGAAGATGAAGACCTGGAGGAGGAGCACTACTTCAGTGACAGCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link