arnt

Ensembl ID:
ENSDARG00000021855
ZFIN ID:
ZDB-GENE-060126-7
Description:
aryl hydrocarbon receptor nuclear translocator isoform a [Source:RefSeq peptide;Acc:NP_001007790]
Human Orthologue:
ARNT
Human Description:
aryl hydrocarbon receptor nuclear translocator [Source:HGNC Symbol;Acc:700]
Mouse Orthologue:
Arnt
Mouse Description:
aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16681 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029485 None 483 503 15 15
ENSDART00000081852 Essential Splice Site 517 728 None 20
ENSDART00000121648 Essential Splice Site 517 746 None 21
ENSDART00000123253 None None 404 None 12
ENSDART00000127554 None None 440 None 13
Genomic Location:
Chromosome 16 (position 5520325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTTCAGGTTTCAGTGCAGACCTGTGGTGTAGTCAGTGCTGAKCACAG[T/C]AAGACTCCTCTCTCACACATATGCATACACTCACTGAAGACAACCCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies a new melanoma susceptibility locus at 1q21.3. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/03oug35i