ahr2

Ensembl ID:
ENSDARG00000021833
ZFIN ID:
ZDB-GENE-990714-16
Description:
aryl hydrocarbon receptor 2 [Source:RefSeq peptide;Acc:NP_571339]
Human Orthologue:
AHR
Human Description:
aryl hydrocarbon receptor [Source:HGNC Symbol;Acc:348]
Mouse Orthologue:
Ahr
Mouse Description:
aryl-hydrocarbon receptor Gene [Source:MGI Symbol;Acc:MGI:105043]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13202 Nonsense Available for shipment Available now
sa37461 Nonsense Mutation detected in F1 DNA During 2016
hu3335 Nonsense Available for shipment Available now
sa18313 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105762 Nonsense 69 1027 2 11
Genomic Location:
Chromosome 22 (position 13282759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCKTCTCAGAAGACGTCCGTGCACGACTGGACAAACTGTCAGTGCTT[C/T]GACTCAGTGTMGGATACCTGAAGGTCAAGAGCTTCTTCAATGGTGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105762 Nonsense 228 1027 6 11
Genomic Location:
Chromosome 22 (position 13192810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACATCCCTCCAGAAAACTCTTCTTTCCTGGAACGAAGTTTCTGTTGC[C/T]GATTCAGATGCCTCCTTGACAACTCGTCAGGCTTCCTGGTAAACATCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105762 Nonsense 534 1027 10 11
Genomic Location:
Chromosome 22 (position 13191368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATTATCGAGGTCGGCAATAATTGCAACAGCCTTGAAGATTTTAATT[T/A]GGACAGGATGGAGCTGAAGGAGTGGGAGAACACTCTGTGCAGGATGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105762 Nonsense 984 1027 10 11
Genomic Location:
Chromosome 22 (position 13190017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAACTACCACTTGGATTACCTCCAGATAACATAATTTCTCAGCAGTA[T/A]CTCTCCTGCAATASCCAGACACAGGTAAACTGTACTAATATGATCCATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link