katna1

Ensembl ID:
ENSDARG00000021827
ZFIN ID:
ZDB-GENE-050522-514
Description:
Katanin p60 ATPase-containing subunit A1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RII9]
Human Orthologue:
KATNA1
Human Description:
katanin p60 (ATPase-containing) subunit A 1 [Source:HGNC Symbol;Acc:6216]
Mouse Orthologue:
Katna1
Mouse Description:
katanin p60 (ATPase-containing) subunit A1 Gene [Source:MGI Symbol;Acc:MGI:1344353]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5672 Nonsense F2 line generated During 2016
sa18250 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5672
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043316 Nonsense 35 485 2 11
ENSDART00000043316 Nonsense 35 485 2 11
Genomic Location (Zv9):
Chromosome 20 (position 23856770)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23975571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGGGAACTACAGCTCTGCGGTGGTCTGTTATCAGGGGGTYCTGGAG[C/T]AAATCAAGAAATACCTCTACTCCGTCAGAGACTCCTCTCTACAGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043316 Essential Splice Site 164 485 4 11
Genomic Location (Zv9):
Chromosome 20 (position 23854300)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23973101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAATCCAAAGAAAAGAAGGAGAACCCGTCAAAGCCAAAAGAAGACAAG[G/A]TGAGGAAGATCKGTGGATCCCTGTTTGGACTAAATCTGATGCGTCATWAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link