katna1

Ensembl ID:
ENSDARG00000021827
ZFIN ID:
ZDB-GENE-050522-514
Description:
Katanin p60 ATPase-containing subunit A1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RII9]
Human Orthologue:
KATNA1
Human Description:
katanin p60 (ATPase-containing) subunit A 1 [Source:HGNC Symbol;Acc:6216]
Mouse Orthologue:
Katna1
Mouse Description:
katanin p60 (ATPase-containing) subunit A1 Gene [Source:MGI Symbol;Acc:MGI:1344353]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4896 Nonsense Mutation detected in F1 DNA During 2014
sa3096 Nonsense Mutation detected in F1 DNA During 2014
sa5672 Nonsense F2 line generated During 2014
sa18250 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043316 Nonsense 16 485 2 11
Genomic Location:
Chromosome 20 (position 23856825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATGAGTTTGGGGGAGATCAATGAGAATGTRAAGCTGGCTCGAGAATA[C/A]GCTCTGCTGGGGAACTACAGCTCTGCGGTGGTCTGTTATCAGGGGGTYCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043316 Nonsense 35 485 2 11
ENSDART00000043316 Nonsense 35 485 2 11
Genomic Location:
Chromosome 20 (position 23856770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGGGAACTACAGCTCTGCGGTGGTCTGTTATCAGGGGGTYCTGGAG[C/T]AAATCAAGAAATACCTCTACTCCGTCAGAGACTCCTCTCTACAGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5672
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043316 Nonsense 35 485 2 11
ENSDART00000043316 Nonsense 35 485 2 11
Genomic Location:
Chromosome 20 (position 23856770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGGGAACTACAGCTCTGCGGTGGTCTGTTATCAGGGGGTYCTGGAG[C/T]AAATCAAGAAATACCTCTACTCCGTCAGAGACTCCTCTCTACAGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043316 Essential Splice Site 164 485 4 11
Genomic Location:
Chromosome 20 (position 23854300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAATCCAAAGAAAAGAAGGAGAACCCGTCAAAGCCAAAAGAAGACAAG[G/A]TGAGGAAGATCKGTGGATCCCTGTTTGGACTAAATCTGATGCGTCATWAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jlluzqj9