cherp

Ensembl ID:
ENSDARG00000021812
ZFIN ID:
ZDB-GENE-040407-1
Description:
calcium homeostasis endoplasmic reticulum protein [Source:RefSeq peptide;Acc:NP_956368]
Human Orthologue:
CHERP
Human Description:
calcium homeostasis endoplasmic reticulum protein [Source:HGNC Symbol;Acc:16930]
Mouse Orthologue:
Cherp
Mouse Description:
calcium homeostasis endoplasmic reticulum protein Gene [Source:MGI Symbol;Acc:MGI:106417]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9494 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028634 Essential Splice Site 78 909 3 19
ENSDART00000110788 None None 532 None 18
ENSDART00000125265 None None 255 None 6
Genomic Location:
Chromosome 22 (position 4628653)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCTTTATAGATTCTGGCACTCATGATGATGAATATAATATGGAAG[G/A]TATTTATTAGACCGATGTTTCAGAAATGTTTCATTTTGCCTGGTATTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mrcc1fi4