calm3a

Ensembl ID:
ENSDARG00000021811
ZFIN IDs:
ZDB-GENE-020415-2, ZDB-GENE-030131-527, ZDB-GENE-030131-5590, ZDB-GENE-030131-8308, ZDB-GENE-030804-3
Description:
Calmodulin [Source:UniProtKB/Swiss-Prot;Acc:Q6PI52]
Human Orthologues:
CALM1, CALM2, CALM3
Human Descriptions:
calmodulin 1 (phosphorylase kinase, delta) [Source:HGNC Symbol;Acc:1442]
calmodulin 2 (phosphorylase kinase, delta) [Source:HGNC Symbol;Acc:1445]
calmodulin 3 (phosphorylase kinase, delta) [Source:HGNC Symbol;Acc:1449]
Mouse Orthologues:
Calm1, Calm2, Calm3
Mouse Descriptions:
calmodulin 1 Gene [Source:MGI Symbol;Acc:MGI:88251]
calmodulin 2 Gene [Source:MGI Symbol;Acc:MGI:103250]
calmodulin 3 Gene [Source:MGI Symbol;Acc:MGI:103249]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8778 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034580 Nonsense 100 149 5 6

The following transcripts of ENSDARG00000021811 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 26556238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCCTGACTTATTGATCCTGTCTGTCTCTGTCAGGACGGGAACGGCTA[C/A]ATCAGTGCGGCAGAGCTTCGCCATGTCATGACAAACCTGGGTGAGAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ejn972l8