nmt2

Ensembl ID:
ENSDARG00000021808
ZFIN ID:
ZDB-GENE-030131-717
Description:
Glycylpeptide N-tetradecanoyltransferase [Source:UniProtKB/TrEMBL;Acc:A7YT82]
Human Orthologue:
NMT2
Human Description:
N-myristoyltransferase 2 [Source:HGNC Symbol;Acc:7858]
Mouse Orthologue:
Nmt2
Mouse Description:
N-myristoyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1202298]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42739 Nonsense Mutation detected in F1 DNA During 2017
sa36160 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012157 Nonsense 13 493 1 14
Genomic Location (Zv9):
Chromosome 16 (position 30806691)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28643829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGATTCATCCATGATGGCGGAGGACAGCGAGTCCGCGGCCAGCCAG[C/T]AGAGCCTGGAGCTGGACGACCAGGACACCTGCGGCATCGATGGAGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012157 Nonsense 155 493 4 14
Genomic Location (Zv9):
Chromosome 16 (position 30808901)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28646039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAAAATATCAGACAAGAGCCATATTCCCTCCCACAGGGTTTTATGTG[G/A]GACACGCTGGACCTTAGCAATGCTGAAGTGGTACGTACATGCATGAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link