hmmr

Ensembl ID:
ENSDARG00000021794
ZFIN ID:
ZDB-GENE-030131-731
Description:
hyaluronan mediated motility receptor [Source:RefSeq peptide;Acc:NP_955874]
Human Orthologue:
HMMR
Human Description:
hyaluronan-mediated motility receptor (RHAMM) [Source:HGNC Symbol;Acc:5012]
Mouse Orthologue:
Hmmr
Mouse Description:
hyaluronan mediated motility receptor (RHAMM) Gene [Source:MGI Symbol;Acc:MGI:104667]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12528 Essential Splice Site Available for shipment Available now
sa13903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031785 Essential Splice Site 99 902 4 23
ENSDART00000105902 Essential Splice Site 100 904 4 20
ENSDART00000121921 Essential Splice Site 99 349 4 12
ENSDART00000125362 Essential Splice Site 99 903 4 20
Genomic Location:
Chromosome 14 (position 29567604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTAGTTTCACTCTTGAAATGAAACATCAGAGACTACTRGAGAAAGAGG[T/C]ACATCTGTTTGYACAAAACATTTTAAATRTTTCTTGGATGACCATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031785 Nonsense 512 902 13 23
ENSDART00000105902 Nonsense 513 904 13 20
ENSDART00000121921 None None 349 None 12
ENSDART00000125362 Nonsense 512 903 13 20
Genomic Location:
Chromosome 14 (position 29575159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCGAGGAGTTRGAGGAYGCGCTTGAGGAGCTGGTGGAGCTGGAGAAG[C/T]AGGAGCARTGCAGTGRAGAGGCCATCCAGCAGCTCACACTGAACAACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/90euh3d1