abcb5

Ensembl ID:
ENSDARG00000021787
ZFIN ID:
ZDB-GENE-030131-6414
Description:
Im:7158730 protein [Source:UniProtKB/TrEMBL;Acc:A9JR76]
Human Orthologues:
ABCB1, ABCB4, ABCB5
Human Descriptions:
ATP-binding cassette, sub-family B (MDR/TAP), member 1 [Source:HGNC Symbol;Acc:40]
ATP-binding cassette, sub-family B (MDR/TAP), member 4 [Source:HGNC Symbol;Acc:45]
ATP-binding cassette, sub-family B (MDR/TAP), member 5 [Source:HGNC Symbol;Acc:46]
Mouse Orthologues:
Abcb1a, Abcb1b, Abcb4, Abcb5
Mouse Descriptions:
ATP-binding cassette, sub-family B (MDR/TAP), member 1A Gene [Source:MGI Symbol;Acc:MGI:97570]
ATP-binding cassette, sub-family B (MDR/TAP), member 1B Gene [Source:MGI Symbol;Acc:MGI:97568]
ATP-binding cassette, sub-family B (MDR/TAP), member 4 Gene [Source:MGI Symbol;Acc:MGI:97569]
ATP-binding cassette, sub-family B (MDR/TAP), member 5 Gene [Source:MGI Symbol;Acc:MGI:1924956]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2844 Essential Splice Site F2 line generated During 2014
sa8683 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2844
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079185 Essential Splice Site 51 601 3 15
ENSDART00000141616 Essential Splice Site 51 1338 3 29
Genomic Location:
Chromosome 16 (position 21523985)
KASP Assay ID:
554-2671.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATGAAGACAAACCAGAGGAGCCACCCAGTGACTCAAAGCACAAAGGG[T/C]ACATACTGATTGAGCAGCAAGTGGATTGTTTTATTMATGTAGAGAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079185 Essential Splice Site 417 601 11 15
ENSDART00000141616 Essential Splice Site 417 1338 11 29
Genomic Location:
Chromosome 16 (position 21517106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAAGGCCCGGGGTGCTGCTTATGAGRTCTACAARACTATTGACATGG[T/C]AAAAACTTTAAGTCTTTTACAGTAAAGGTCATTTTTTATTATATTTATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rcg88fpw