si:dkey-211e20.5

Ensembl ID:
ENSDARG00000021776
ZFIN ID:
ZDB-GENE-081030-14
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29838 Nonsense Mutation detected in F1 DNA Unknown

Mutation Details

Allele Name:
sa29838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050026   None 289 None 5
ENSDART00000140241 Nonsense 313 409 6 6

The following transcripts of ENSDARG00000021776 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39885288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCACATCAATGTCTCGAGCTGTCTGATGATCTGACCAGAGTGACATA[A/G]AGAGGAATACAACCAGTTCCTGATAATCCAGAGAGATTTGACTGTTATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link