ccdc25

Ensembl ID:
ENSDARG00000021753
ZFIN ID:
ZDB-GENE-040426-1389
Description:
Coiled-coil domain-containing protein 25 [Source:UniProtKB/Swiss-Prot;Acc:Q7T312]
Human Orthologue:
CCDC25
Human Description:
coiled-coil domain containing 25 [Source:HGNC Symbol;Acc:25591]
Mouse Orthologue:
Ccdc25
Mouse Description:
coiled-coil domain containing 25 Gene [Source:MGI Symbol;Acc:MGI:1914429]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6646 Nonsense Mutation detected in F1 DNA During 2014
sa10148 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037282 Nonsense 23 207 2 9

The following transcripts of ENSDARG00000021753 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 39368393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWACAGTTGTCTCACCGCCCCATACTATCTACATGGGCAAAGATAAATA[T/A]GAAAGTAAGTGCTTATTTTMTYATAAATATTAYTTTAAAWGCACACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037282 Nonsense 140 207 7 9

The following transcripts of ENSDARG00000021753 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 39366253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATCAACGAAAYCGTCAACAGACTAGAGAAAACAAAAGAGGAACGGTA[T/A]CCAGACCTTGCTGCTGAGAAAGARTCYCGAGACAGAGAGGAAAGAAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/heilr8un