cacna1ba

Ensembl ID:
ENSDARG00000021735
ZFIN ID:
ZDB-GENE-060531-44
Description:
voltage-dependent N-type calcium channel subunit alpha-1B [Source:RefSeq peptide;Acc:NP_001108020]
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1562 Nonsense F2 line generated During 2014
sa5297 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20443 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20442 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1562
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 370 2312 8 48
ENSDART00000141154 Nonsense 370 2270 8 46
Genomic Location:
Chromosome 5 (position 31016641)
KASP Assay ID:
554-1505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGGAGCGAGAGCGTGTGGAGAAAAGACAGGAGTTCTTAAAGCTGCGC[A/T]GACAACAGCAGATCGAAAGAGAGTTAACCGGATAYCTGGAGTGGATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 556 2312 13 48
ENSDART00000141154 Essential Splice Site 556 2270 13 46
Genomic Location:
Chromosome 5 (position 31006139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGTGCKTTGTTTCCAAGTATAAATAAAAGTGTATTTCTATTTGCTCA[G/T]GTGATTGTGGGGAGCATTTTCGAGGTGATCTGGGCTGCAGTAAAGCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 1186 2312 23 48
ENSDART00000141154 Essential Splice Site 1165 2270 22 46
Genomic Location:
Chromosome 5 (position 30982235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCTGGCTGCAGAAGACCCGGTCCAAGCCAATGCACCTCGGAACAATG[T/C]GAGCTGTTTTATCTGTGCTAAACGGGATGTCAGATTTTGACCTCATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 1191 2312 24 48
ENSDART00000141154 Nonsense 1170 2270 23 46
Genomic Location:
Chromosome 5 (position 30982114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTAACTGAAGACCATTTTATTTTTCGCTTCACAGGTCCTGAAGTATT[T/A]GGACTATGTCTTCACTGGTGTTTTCACATTCGAGATGGTCATTAAGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tm7ed1h3