COL7A1

Ensembl ID:
ENSDARG00000021720
Description:
collagen, type VII, alpha 1 [Source:HGNC Symbol;Acc:2214]
Human Orthologue:
COL7A1
Human Description:
collagen, type VII, alpha 1 [Source:HGNC Symbol;Acc:2214]
Mouse Orthologue:
Col7a1
Mouse Description:
collagen, type VII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88462]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20773 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20772 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20771 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5379 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12429 Essential Splice Site Available for shipment Available now
sa1097 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa20773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 670 1561 36 81
Genomic Location:
Chromosome 6 (position 40152723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGGAAGAGCCGGTGAACTTGGAGAAGCTGGCAGACCTGGGGAGAAG[G/A]TAACAAATAAAAATGCATTAGGATTTTGTCACTGTATCTTTTTTTATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 824 1561 45 81
Genomic Location:
Chromosome 6 (position 40147397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTCTTGTTTAGGGTGACCATGGAGAACCAGGCATTGGAGTTCAAG[T/A]AAGTTTTCCAACTGAGTAGCGATAGAATGCTTTCCTTCAGGCGGTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 919 1561 50 81
Genomic Location:
Chromosome 6 (position 40143991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGCTGTGCAGTCTGTCACCGGACCCCCTGGAATGAAGGGTGAGATG[G/C]TGAGTTGTTGCCATGGTTACATCATAGCGAACACTGTGTGCAGATCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 1064 1561 56 81
Genomic Location:
Chromosome 6 (position 40140228)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGGAAATCCAGGAACACCAGGAGATGCTGGACCACCTGGACCCACT[G/A]TAAGTCACTGAYAGGTTCAARTTAAATAKTGTGTGTAGGCATTTAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 1178 1561 63 81
Genomic Location:
Chromosome 6 (position 40135348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGGTGAAAAGGGTGCAAAGGGACAGGAAGGACCACCAGGAGAACAG[G/T]CAAGAATTTTTATCAWCTATTTATAATGTATTTMAAAATGGTAAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1097
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Nonsense 1251 1561 68 81
Genomic Location:
Chromosome 6 (position 40131285)
KASP Assay ID:
554-0999.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAGCTTTAATGGCTTACAGGGGGAACGAGGCTCCAAGGGGGTTTGT[G/T]GACCAAGCGGACAAAAGGGAGACAAGGTGAGTAACATGGAGAGCTTGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/appciphd