COL7A1

Ensembl ID:
ENSDARG00000021720
Description:
collagen, type VII, alpha 1 [Source:HGNC Symbol;Acc:2214]
Human Orthologue:
COL7A1
Human Description:
collagen, type VII, alpha 1 [Source:HGNC Symbol;Acc:2214]
Mouse Orthologue:
Col7a1
Mouse Description:
collagen, type VII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88462]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33922 Nonsense Mutation detected in F1 DNA During 2016
sa20773 Essential Splice Site Available for shipment Available now
sa33921 Nonsense Mutation detected in F1 DNA During 2016
sa38571 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20772 Essential Splice Site Available for shipment Available now
sa20771 Essential Splice Site Available for shipment Available now
sa33920 Essential Splice Site Available for shipment Available now
sa12429 Essential Splice Site Available for shipment Available now
sa26794 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1097 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa33922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Nonsense 277 1561 18 81
Genomic Location (Zv9):
Chromosome 6 (position 40168404)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40240004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGCCACATCCTAACTGTGGTCTATTAATGTTTTAGGGACTGCCAGGT[C/T]AATCAGGTCAACCTGGGACAAAAGGAGACACAGGCGATCCAGGGGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 670 1561 36 81
Genomic Location (Zv9):
Chromosome 6 (position 40152723)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40224323
KASP Assay ID:
554-6474.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGGAAGAGCCGGTGAACTTGGAGAAGCTGGCAGACCTGGGGAGAAG[G/A]TAACAAATAAAAATGCATTAGGATTTTGTCACTGTATCTTTTTTTATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Nonsense 720 1561 39 81
Genomic Location (Zv9):
Chromosome 6 (position 40151327)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40222927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGTGGTTTGCCTGGTCCAAGGGGTCTGCCAGGCCCTGCAGGTGTC[C/T]GAGGAGAGCCAGGTGCAGTAGGACCTCAAGGATCTCCTGGAGAGCGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 824 1561 45 81
Genomic Location (Zv9):
Chromosome 6 (position 40147398)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40218998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTTTCTTGTTTAGGGTGACCATGGAGAACCAGGCATTGGAGTTCAA[G/A]TAAGTTTTCCAACTGAGTAGCGATAGAATGCTTTCCTTCAGGCGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 824 1561 45 81
Genomic Location (Zv9):
Chromosome 6 (position 40147397)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40218997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTCTTGTTTAGGGTGACCATGGAGAACCAGGCATTGGAGTTCAAG[T/A]AAGTTTTCCAACTGAGTAGCGATAGAATGCTTTCCTTCAGGCGGTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 919 1561 50 81
Genomic Location (Zv9):
Chromosome 6 (position 40143991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40215591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGCTGTGCAGTCTGTCACCGGACCCCCTGGAATGAAGGGTGAGATG[G/C]TGAGTTGTTGCCATGGTTACATCATAGCGAACACTGTGTGCAGATCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 1064 1561 56 81
ENSDART00000033844 Essential Splice Site 1064 1561 56 81
Genomic Location (Zv9):
Chromosome 6 (position 40140228)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40211828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGGAAATCCAGGAACACCAGGAGATGCTGGACCACCTGGACCCACT[G/T]TAAGTCACTGACAGGTTCAAATTAAATAGTGTGTGTAGGCATTTAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 1178 1561 63 81
Genomic Location (Zv9):
Chromosome 6 (position 40135348)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40206948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGGTGAAAAGGGTGCAAAGGGACAGGAAGGACCACCAGGAGAACAG[G/T]CAAGAATTTTTATCAWCTATTTATAATGTATTTMAAAATGGTAAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Essential Splice Site 1202 1561 64 81
Genomic Location (Zv9):
Chromosome 6 (position 40132309)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40203909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGTTCAACCGGCTTCCAAGGAGCACGCGGCCCTGGTGGCCAGAAGG[T/G]GAAATAAAAACTCTCCTCGACACATGCATATACATGAATACATTCGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1097
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033844 Nonsense 1251 1561 68 81
Genomic Location (Zv9):
Chromosome 6 (position 40131285)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40202885
KASP Assay ID:
554-0999.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAGCTTTAATGGCTTACAGGGGGAACGAGGCTCCAAGGGGGTTTGT[G/T]GACCAAGCGGACAAAAGGGAGACAAGGTGAGTAACATGGAGAGCTTGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link