pdcd4a

Ensembl ID:
ENSDARG00000021702
ZFIN ID:
ZDB-GENE-040426-1920
Description:
programmed cell death 4a [Source:RefSeq peptide;Acc:NP_998153]
Human Orthologue:
PDCD4
Human Description:
programmed cell death 4 (neoplastic transformation inhibitor) [Source:HGNC Symbol;Acc:8763]
Mouse Orthologue:
Pdcd4
Mouse Description:
programmed cell death 4 Gene [Source:MGI Symbol;Acc:MGI:107490]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6587 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030141   None 467 None 11
ENSDART00000147595 Essential Splice Site None 467 None 12

The following transcripts of ENSDARG00000021702 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24945561)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25369259
KASP Assay ID:
554-4963.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAACATTACTGTTAMATCTTTAGTCACAAGCGAGCCTTCAATTTAAGG[T/C]AAGGCTAAGCTCYACGCATTTACGAATGAAATGTANNNNNNCATTAAGACGGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link