mxa

Ensembl ID:
ENSDARG00000021688
ZFIN ID:
ZDB-GENE-030721-5
Description:
Interferon-induced GTP-binding protein MxA [Source:UniProtKB/Swiss-Prot;Acc:Q8JH68]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38242 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103588 Nonsense 119 632 3 12
ENSDART00000122566 Nonsense 119 645 3 13
Genomic Location (Zv9):
Chromosome 1 (position 6490147)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6884942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTAATATCTTATTTCCTATTGTGTTTGCAGCCCAAGATGAGATGGCT[G/T]GAGCAGGTGTTGGTATCAGTGAAGAACTCATCAGTCTGCAGATCACCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link