sec61al1

Ensembl ID:
ENSDARG00000021669
ZFIN ID:
ZDB-GENE-020418-2
Description:
Protein transport protein Sec61 subunit alpha-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q90ZM2]
Human Orthologue:
SEC61A1
Human Description:
Sec61 alpha 1 subunit (S. cerevisiae) [Source:HGNC Symbol;Acc:18276]
Mouse Orthologue:
Sec61a1
Mouse Description:
Sec61 alpha 1 subunit (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1858417]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40755 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31532 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034730 Essential Splice Site 154 476 6 12
Genomic Location (Zv9):
Chromosome 6 (position 40000079)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40071679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACCCTTCAGAGATGGGTGCTGGCATCTGTCTGCTGATCATCATTCAG[G/A]TGAGAGAGCATGGACACAATGTGTGTATTTATTACCTGTATAATGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034730 Nonsense 474 476 12 12
Genomic Location (Zv9):
Chromosome 6 (position 39997125)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40068725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAGATATTTGTTAAGGAACAGAGTGAAGTCGGCAGCATGGGAGCGT[T/G]ACTCTTCTAAACAAGGACACTCACAAACACACACATACTTGCTGACACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link