fzd3

Ensembl ID:
ENSDARG00000021664
ZFIN ID:
ZDB-GENE-990415-225
Description:
frizzled-3 [Source:RefSeq peptide;Acc:NP_001036226]
Human Orthologue:
FZD3
Human Description:
frizzled homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:4041]
Mouse Orthologue:
Fzd3
Mouse Description:
frizzled homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108476]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8665 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090549 Nonsense 114 685 2 6
ENSDART00000113294 Nonsense 114 639 3 7
Genomic Location:
Chromosome 20 (position 35251764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCYTSCCATGTCGCCGYCTGTGCCAGCGGGCTAAGAGCGACTGCTAC[A/T]AGCTCATGGAGATGTTTGGGGTCAGCTGGCCAGATGAGATGGAGTGTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/81ghov7w